Closed:what is stem loop in miRNA at miRBase data base?

Question

[jack]

Hi all,

I'm searching for the miRNAs in miRBase database. when I enter the ID of miRNA, I get following information:

Accession number    MIMAT0000062
ID                  hsa-let-7a-5p
Previous IDs        hsa-let-7a
Sequence            ugagguaguagguuguauaguu
                    Get sequence
Stem-Loop           hsa-let-7a-1 hsa-let-7a-2 hsa-let-7a-3

I want to figure out, what is the Stem-loop and is it functional inside of cell?

---

EDIT on 9/23/2021 by @Ram:

Removed the links from the code block above and added them here:

1. Get sequence
2. hsa-let-7a-1
3. hsa-let-7a-2
4. hsa-let-7a-3