start and stop position of mapping in Blast
Entering edit mode
10.1 years ago

I used makeblastdb to search many short fasta sequences in a known organism. I successfully completed this step and got the mappings. My question is

How can I get the start and stop coordinate?

for eg


Query  61       ttttAGGAGGTATAGCAAATGG  82
Sbjct  1765121  TTTTAGGAGGTATAGCAAATGG  1765100

How to get 1765100 and 1765181 from a text file with many mappings like this. I would also like to count the number of mappings or query sequences?

blast • 6.0k views
Entering edit mode

use tabular output option:

blastn -query some.fa -db some.fa  -outfmt 6
Entering edit mode

Thank You :)

Entering edit mode

Every bioinformatics journey begins with a BLAST parser :)

Entering edit mode
10.1 years ago
blastn -query some.fa -db some.fa  -outfmt 6 | awk '{print $9 "\t" $10}'
Entering edit mode

in case alignment of query is in opposite direction to subject, then column 9 will be greater than column 10

blastn -query query.fa -db subject.fa  -outfmt 6 | awk '{OFS="\t"; if ($9>$10) print $9,$10; else print $10,$9}'
Entering edit mode

Have in mind that sometimes $9 is greater than $10.

Also, there is no point in your answer as you're blasting some.fa against some.fa.

Entering edit mode

there are some cases when you run blast using query both as query and as subject, clustering groups of sequences for example.


Login before adding your answer.

Traffic: 3636 users visited in the last hour
Help About
Access RSS

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6