Question: Help on Random DNA Mutant Strand Generator
0
gravatar for abenabba
6.5 years ago by
abenabba0
United States
abenabba0 wrote:

I'd like to create a dictionary of dictionaries for a series of mutated DNA strands, with each dictionary demonstrating the original base as well as the base it has mutated to.

To elaborate, what I would like to do is create a generator that allows one to input a specific DNA strand and have it crank out 100 randomly generated strands that have a mutation frequency of 0.66% (this applies to each base, and each base can mutate to any other base). Then, what I would like to do is create a series of dictionary, where each dictionary details the mutations that occured in a specific randomly generated strand. I'd like the keys to be the original base, and the values to be the new mutated base. Is there a straightforward way of doing this? So far, I've been experimenting with a loop that looks like this:

#yields a strand with an A-T mutation frequency of 0.066%
def mutate(string, mutation, threshold):
    dna = list(string)
    for index, char in enumerate(dna):
        if char in mutation:
            if random.random() < threshold:
                dna[index] = mutation[char]

    return ''.join(dna)

dna = "ATGTCGTACGTTTGACGTAGAG"
print("DNA first:", dna)
newDNA = mutate(dna, {"A": "T"}, 0.0066)
print("DNA now:", newDNA)

But I can only yield one strand with this code, and it only focuses on T-->A mutations. I'm also not sure how to tie the dictionary into this. could someone show me a better way of doing this? Thanks.

genome • 1.9k views
ADD COMMENTlink modified 6.3 years ago by Biostar ♦♦ 20 • written 6.5 years ago by abenabba0
2

Hello abenabba!

It appears that your post has been cross-posted to another site: http://stackoverflow.com/questions/24050294

This is typically not recommended as it runs the risk of annoying people in both communities.

ADD REPLYlink written 6.5 years ago by Pierre Lindenbaum131k

It might help if you can explain your over-all goal. The way you are doing it at the moment you'll only ever be able to mutate a given base to one other base (dictionaries can only take one value per key, although it can be a container). Likewise, the mutation dictionary you want to create for each sequence will ever contain key-value pairs from the dictionary you provide to "mutate"

If you can spell out your over all goals a little more clearly users might be able to suggest a different approach.

ADD REPLYlink modified 11 months ago by _r_am31k • written 6.5 years ago by David W4.8k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1847 users visited in the last hour