Off topic:How to inroduce mutations to fasta files?
2
0
Entering edit mode
6.8 years ago
lilachfr • 0

Hi,

I have a list of mutations and their genomic positions.

for example:  

chr1:1573209-1573209 T>A

and I have fasta sequences of the consenus sequence around the sites of thes mutations.

 

for example:

>hg19_ct_UserTrack_3545_CDK11A range=chr1:1573157-1573247 5'pad=10 3'pad=10 strand=+ repeatMasking=lower
GAGGATGGTGTTGATCTCCCTCAGCGACGTGATCGGGAAGCCCTCCTTCT
CCTTCTCCATCTTCAGCCGCTTTAGAGCCACAATTTCATCT

 

Is there any tool that can insert the mutation into the fasta?

and more complicated - a tool that can combine several different mutations in the same fasta? 

I wrote a perl script that creates a fasta for each mutation, but now I need to create all possible combinations of mutations (i.e. if there are 3 different mutations in a single fasta sequence, I need all the combincations: mut1 + mut2, mut2 + mut3, mut1 + mut2 + mut3), and I wonder if there is an existing tool that can do that.

 

Thanks in advacne for any help

 

SNP sequence next-gen • 2.3k views
ADD COMMENT
This thread is not open. No new answers may be added
Traffic: 1073 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6