How to determine to which strains of S. pneumoniae these FASTQ files belong to?

Question

[John Smith]

This is a continuation to my previous question. I am working with this study given in the answer to the question. I realized that I can look up the reference genome of many strains in the "Assembly" section of the ENA search results but I cannot figure out to which specific strains of S. pneumoniae the FASTQ files for each run belong to. I am assuming that each of these is a run:

To summarize the previous question, I am looking for two strains of S. pneumoniae for which I can obtain their raw sequencing data in FASTQ format along with being able to find their reference genomes in FASTA format.

I tried looking at the descriptions on the FASTQ files but I cannot understand them. They are different from the ones that I have seen before. If it is of any help, here are the first lines of File 1 as shown in the picture above:

@ERR015599.1 IL32_4347:7:1:1028:16291/1
CGATCACCCTNTCAGGTCGGCTATGTNNNGTCGCCTTGGTGAGCCGTTACCCCA
+
F=FAFFFDAD!FE?F<AEAAB>>A?A!!!;>@@?7FE?;6/??C9@;;;CA?A:
@ERR015599.2 IL32_4347:7:1:1028:8103/1
CCGCTCTCCTNCCATACCTATAAAGGNNNCCACAGCTTCGGTAAATTGTTTTAG
+
IIIFICFGGI!DGDGBADHAICECGB!!!B<@A@>BA=GE@A8A?CFB@BCE?>
@ERR015599.3 IL32_4347:7:1:1028:14106/1
GTTTCCAATAGTTATCCCCCGCTACCAGGCAGGTTACCTACGCGTTACTCACCC
+
D?F>FB+AB??@F6BFFFFF<A@7BA?;>B5>>:>@@D@@E@F5=7;B=A7AA>
@ERR015599.4 IL32_4347:7:1:1029:17190/1
CTGCATCTTCACAGGTACTAAAATTTCACCGAGTCTCTCGTTGAGACAGTGCCC
+
G;;;;<:;709<<7>@@@C<@A:=9AA>A>>@>AC:777<@@@>7(<,-:49&.
@ERR015599.5 IL32_4347:7:1:1029:19289/1
AGGGGCCTTAGCTGGTGGTCTGGGCTGTTTCCCTTTCGACTACGGATCTTAGCA
+
A@ABFACDEGGGFF>DGE:DGEGGAG=EDEGG@GGEEGEGG>EGG6CA@CGFGG

Answer 1

[Devon Ryan]

They have a key on the main web page, which you could have trivially found by following some links (you really shouldn't need someone else to do this for you). That particular example is from an unknown strain.

[John Smith]

I see, I tried the link before and I just assumed that the site was broken since it did not work for Firefox in my version of Ubuntu nor for Chromium. It worked on Firefox on Windows but I had to ask a script on the site to stop running before I could navigate. I thought I was missing something obvious since the original study was given to me by a user as a response to the previous question and I thought that the link in it was broken. Now I can see the table that lists the strains.

Edit: The link still does not seem to work. I don't how it worked once on Windows.

[John Smith]

I solved it. One has to delete the cookies for the site and then open it again. Apparently there is a buggy script running on the site.

[Devon Ryan]

It tried to freeze firefox on my Mac too.