Question: eprimer3 and primer3 incompatible still?
1
gravatar for shuelga
5.5 years ago by
shuelga20
United States
shuelga20 wrote:

I am using the most up to date version of emboss (6.6.0) and primer3 (2.3.6), yet I STILL cannot get them to run correctly. I've searched around for a lot of help on this and have followed many of the recommendations, but nothing works. Currently when I run eprimer32 I get a seg fault which I think is coming from primer3? And when I run eprimer3 I get the SEQUENCE_TAG error. Are there any additional recommendations that you may have that I have not been able to find online?

Things I  have tried:

- using eprimer32 instead with the copied version of primer32_core

- set the EMBOSS_PRIMER3_CORE variable

- use current option names

- calling eprimer3 from command line and also from BioPython Primer3CommandLine

- I've seen this too eprimer3 and primer3 compatibility problem and it lead me to no answers.

 

This is the command (attached is my input seq):

eprimer32 -outfile=./eprimer_out -sequence=./eprimer_in_seq -task=2 -includedregion=1,40 -optsize=35 -minsize=35 -maxsize=35 -opttm=65 -mintm=40 -maxtm=100 -maxdifftm=100 -mingc=10 -maxgc=90 -prange=40,200

My input file:

GCCCCTTTGAAATGATGGTGTCAGAGTGCAGAGAAACAATGGAGTTTTGATGCCAAAAAGGTTTTTTTGCAGTAAAAGTAAAAATTTGGAATTAGTTGGCATATAGAGGAACCCTTTTGTACTGGAACGTATGAGGCTGGATTGTGAAAAGGTAATCTTTCGATTGCTAGACTTGGTTAACTTAGGGCTGCAAATCTTTTTCTTCTGTCAAGGTCACTTAATATGGAATGTTTTTGTCAGA

 

 

eprimer3 • 1.8k views
ADD COMMENTlink modified 4.8 years ago by Owen S.350 • written 5.5 years ago by shuelga20

I am getting seg fault as well. Reported this as a bug to emboss and I will try to update this thread with a link when it is available.

ADD REPLYlink written 5.4 years ago by Paweł Sztromwasser20
0
gravatar for Owen S.
4.8 years ago by
Owen S.350
Oakland CA
Owen S.350 wrote:

I was also having this problem. I remember this problem when it first popped up 5 years ago or so, and so I am in disbelief to be dealing with this 5 years later on a fresh install of "emboss" package on a new Ubuntu 14.04 box.  I assume the fault is with the package maintainers, and not EMBOSS.

A (partial) solution is to use eprimer32 and also set the env var EMBOSS_PRIMER32_CORE.  Following shows two ways that don't work, and the third example is working.  The reason I say it is "partial" is that I am not sure this solution will work for those trying to access Primer3 via Bio.Emboss.Applications.Primer3Commandline

Non-working example 1:

$ eprimer3 -sequence gapdh.fasta -stdout                                                                     
Pick PCR primers and hybridization oligos
Whitehead primer3_core program output file [stdout]: 
Error: Missing SEQUENCE tag
# EPRIMER3 RESULTS FOR 6534405-6538375
#                      Start  Len   Tm     GC%   Sequence

Non-working example 2:

$ eprimer32 -sequence gapdh.fasta -stdout                                                                    
Pick PCR primers and hybridization oligos
Died: eprimer32 uses external program 'primer32_core' which is not in the PATH or defined as EMBOSS_PRIMER32_CORE
     Part of the 'primer3' package, version 2.2.3, available from the
     Whitehead Institute. See: http://primer3.sourceforge.net/ The
     primer3_core application must be renamed to primer32_core

Working example 3:

$ EMBOSS_PRIMER32_CORE=/usr/bin/primer3_core eprimer32 -sequence gapdh.fasta -stdout                       
Pick PCR primers and hybridization oligos
Whitehead primer3_core program output file [stdout]: 
# EPRIMER32 RESULTS FOR 6534405-6538375
#                      Start  Len   Tm     GC%   Sequence
   1 PRODUCT SIZE: 199
     FORWARD PRIMER    2248   20  59.82  60.00  CAGCCCCTTCATACCCTCAC
     REVERSE PRIMER    2427   20  60.03  55.00  AGCCACACCATCCTAGTTGC
   2 PRODUCT SIZE: 199
     FORWARD PRIMER    3469   20  60.18  60.00  GCATCCTGGGCTACACTGAG
     REVERSE PRIMER    3648   20  60.11  50.00  TTTTTCTGAGCCAGCCACCA
   3 PRODUCT SIZE: 204
     FORWARD PRIMER    1371   20  60.11  60.00  GGAAACCAGATCTCCCACCG
     REVERSE PRIMER    1555   20  59.96  60.00  TTAACCCCCTAGTCCCAGGG
   4 PRODUCT SIZE: 194
     FORWARD PRIMER    3007   20  60.04  60.00  GACTGAGGCTCCCACCTTTC
     REVERSE PRIMER    3181   20  60.03  55.00  AGTGATGGCATGGACTGTGG
   5 PRODUCT SIZE: 194
     FORWARD PRIMER    1555   20  59.96  60.00  CCCTGGGACTAGGGGGTTAA
     REVERSE PRIMER    1729   20  60.04  55.00  CTAGCTCAGCTGCACCCTTT

 

 For the record, this is on Ubuntu 14.04, with emboss 6.6.0 install via apt.

apt-cache show emboss
Package: emboss
Priority: optional
Section: universe/science
Installed-Size: 4112
Maintainer: Ubuntu Developers <ubuntu-devel-discuss@lists.ubuntu.com>
Original-Maintainer: Debian Med Packaging Team <debian-med-packaging@lists.alioth.debian.org>
Architecture: amd64
Version: 6.6.0-1
Depends: emboss-lib (= 6.6.0-1), libc6 (>= 2.14), libexpat1 (>= 2.0.1), libx11-6, zlib1g (>= 1:1.1.4), emboss-data (= 6.6.0-1)
Recommends: primer3, dialign
Suggests: emboss-doc, emboss-test, embassy, clustalw
Filename: pool/universe/e/emboss/emboss_6.6.0-1_amd64.deb
Size: 953186
MD5sum: 3f3ed81fd191d9c431d7636a558a9001
SHA1: 467970bc7328ba7de41e81f2d7bed083151da411
SHA256: 32cfbae45b21441114506d719c6627fc72060a67a5bdf74bcb49ce9cb46d5e12
Description-en: european molecular biology open software suite
 EMBOSS is a free Open Source software analysis package specially developed for
 the needs of the molecular biology (e.g. EMBnet) user community. The software
 automatically copes with data in a variety of formats and even allows
 transparent retrieval of sequence data from the web. Also, as extensive
 libraries are provided with the package, it is a platform to allow other
 scientists to develop and release software in true open source spirit. EMBOSS
 also integrates a range of currently available packages and tools for sequence
 analysis into a seamless whole. EMBOSS breaks the historical trend towards
 commercial software packages.
Description-md5: 4f3d6a457939538fb5f7639f0452d33e
Homepage: http://emboss.sourceforge.net
Bugs: https://bugs.launchpad.net/ubuntu/+filebug
Origin: Ubuntu

$ uname -a
Linux vagrant-ubuntu-trusty-64 3.13.0-45-generic #74-Ubuntu SMP Tue Jan 13 19:36:28 UTC 2015 x86_64 x86_64 x86_64 GNU/Linux
ADD COMMENTlink written 4.8 years ago by Owen S.350
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1715 users visited in the last hour