Question: Runnig tuxedo with SOLID data (color_space_index)
0
gravatar for Veli Kaan Aydin
4.5 years ago by
Turkey
Veli Kaan Aydin40 wrote:

Hello everyone,

I'm trying to run tuxedo pipeline on ubuntu. But I need to use color command to get the results (  I am not sure if it is correct way to analyze SOLID data). Common usage: tophat --color --quals [other options]* <colorspace_index_base> <reads1_1[,...,readsN_1]> [reads1_2,...readsN_2] <quals1_1[,...,qualsN_1]> [quals1_2,...qualsN_2] I know that but here is my problem; I do not know how to find colorspace_index_base or is there a way for change the solid fastq to illumina fastq.

 

Thanks.

ADD COMMENTlink modified 4.5 years ago by Biostar ♦♦ 20 • written 4.5 years ago by Veli Kaan Aydin40

Did you download the index or did you make it yourself? If you've done neither, then you need to use bowtie-build.

ADD REPLYlink written 4.5 years ago by Devon Ryan88k

I search and I did not find now I'm doing bowtie-build ( bowtie-build -C SRR121576.fastq SRR121576)

ADD REPLYlink written 4.5 years ago by Veli Kaan Aydin40

Ah, you can go ahead and stop that command, it's not what you want. You'll need to either download an index from iGenomes (I assume the files include colorspace indices, but I don't know that for sure), or download the reference genome from UCSC/Ensembl/etc. and use bowtie-build with that.

Since you're very new to this, I'd recommend trying to find someone locally to help you out a bit (that'll get you finished with your analysis a bit more quickly). Alternatively, try to find a course that goes through some of the basics. I know there are some offered in Germany by ecSeq, and I presume there's something similar in Turkey.

ADD REPLYlink written 4.5 years ago by Devon Ryan88k

I understand you thank you for help :)

ADD REPLYlink written 4.5 years ago by Veli Kaan Aydin40

Devon, Can you write me the reasons of "Error running 'prep_reads' terminate called after throwing an instance of 'int' "  I already download hg 18 colorspace from Bowtie web site and

I fastq-dump some solid SRR (rna-seq) and "tophat -C -o output --bowtie1 colorindex SRR.fastq

And do you see any thing wrong in this code? because it still gives the error

 

ADD REPLYlink written 4.5 years ago by Veli Kaan Aydin40

It's unclear. Perhaps post a couple lines for the SRR.fastq file. Hopefully someone more versed in colorspace will see this, since I pretty much never use colorspace datasets (they're pretty antiquated these days).
 

ADD REPLYlink written 4.5 years ago by Devon Ryan88k

thanks for everything. Is there any pipeline that I can use analyzing SOLID data that you suggest? 

ADD REPLYlink written 4.5 years ago by Veli Kaan Aydin40

That's unfortunately not something I have enough experience with to offer any advice. Tophat should work, but if it's not then finding out why may not be trivial unless you can code.

ADD REPLYlink written 4.5 years ago by Devon Ryan88k

Hello Devon I need to ask another question to you ;

Let me write log and commmand after I'll add my files first lines.;

/rnaseq$ tophat --bowtie1 --color -p 8 -G genes.gtf -o output_yenisra77 hg18_c yenisra77.fastq

[2014-08-23 22:33:13] Beginning TopHat run (v2.0.12)
-----------------------------------------------
[2014-08-23 22:33:13] Checking for Bowtie
          Bowtie version:     1.1.0.0
[2014-08-23 22:33:13] Checking for Samtools
        Samtools version:     0.1.19.0
[2014-08-23 22:33:13] Checking for Bowtie index files (genome)..
[2014-08-23 22:33:13] Checking for reference FASTA file
    Warning: Could not find FASTA file hg18_c.fa
[2014-08-23 22:33:13] Reconstituting reference FASTA file from Bowtie index
  Executing: /home/veli/calisma/bwt1/bowtie-inspect hg18_c > output_yenisra77/tmp/hg18_c.fa
[2014-08-23 22:35:52] Generating SAM header for hg18_c
[2014-08-23 22:36:28] Reading known junctions from GTF file
[2014-08-23 22:36:30] Preparing reads
    [FAILED]
Error running 'prep_reads'
terminate called after throwing an instance of 'int'

 

This is my fastq file;

@SRR121577.1 head0094_20091130_2_CD8_M14_15_427_13_15_F3 length=35
ATTANAAANNNNNNTNTGCCNNNNNNNGANNNNGG
+
A<%%!!<>!%3*+*!!!().!'6%+02!+!+25!/
@SRR121577.2 head0094_20091130_2_CD8_M14_15_427_13_159_F3 length=35
TATANTACNNNNNNGNTAGTNNNNNNNGCNNNNTA
+
2<%B!!B-!61:(1!!!%%+!2-.&&8!6!(1%!0
@SRR121577.3 head0094_20091130_2_CD8_M14_15_427_13_303_F3 length=35
TACTNAGTNNNNNNGNTTTGNNNNNNNGANNNNCA
+
>B10!!)A!79B>%!!!9'4!@7/63%!%!)</!%
@SRR121577.4 head0094_20091130_2_CD8_M14_15_427_14_630_F3 length=35
ATGCANNNCGCGCGNNTACGCGAGTGTAGATATNN
+
(%'&&!)(!(')%%!%!%%%%'&%%&'%%%%%%!%
@SRR121577.5 head0094_20091130_2_CD8_M14_15_427_15_5_F3 length=35
TATCGNNNCGACTCNNNNNNNNNNNNNNNNNNNTC
+
%8*&4!/1!<2<)%!@;003,+,,-''6*1/%7!)
@SRR121577.6 head0094_20091130_2_CD8_M14_15_427_15_14_F3 length=35
ATAACNNNTTAAAGNNAATGGCGTATAGGTTAANN
+
4=*%;!*6!1&&/)!(!%2',(%(*%+(3'%%)!'
@SRR121577.7 head0094_20091130_2_CD8_M14_15_427_15_160_F3 length=35
TAATANNNGTATTANNGCGTCGGCGATATGTAGNN
+
.B*A6!A)!07>.1!%!4+%&6%%)*2%(%%(%!,
@SRR121577.8 head0094_20091130_2_CD8_M14_15_427_15_301_F3 length=35
TACACNNNCGCGAANNGGTGTAATGTAACGTAANN
+
0B5%;!0=!&%A/%!,!0%%&<3%%%&3%(&&%!(
@SRR121577.9 head0094_20091130_2_CD8_M14_15_427_17_7_F3 length=35
TATCGCGAATCAATNNNNNNNNNNNNNNNNNNNGC
+
%?010?)*'=%2*%!?8'(.(&)*%'%''1(2/!-
@SRR121577.10 head0094_20091130_2_CD8_M14_15_427_17_1697_F3 length=35
ATATGNNNNNNNNNTATAAGTGTTGTGTCATGTNN
+
(%%+)!.%%)')+*!%''%%%&%%5%'%&(%(%!%
@SRR121577.11 head0094_20091130_2_CD8_M14_15_427_20_19_F3 length=35
TATGTTATACTAACTGTGTGAACCGACATGGCTNN
+
'<2>1.65A269<4*1050'4/%9(4:(63;,%!0
@SRR121577.12 head0094_20091130_2_CD8_M14_15_427_20_35_F3 length=35
ATCTGCGGCATTCANNNNNNNNNNNNNNNNNNNGA
+
'?%%'&6%%%&8%%!&'%%%%<%%%%&%'%%%%!%
@SRR121577.13 head0094_20091130_2_CD8_M14_15_427_20_37_F3 length=35
TAGACGCTCCTTATCGCAGACGAGGTTGTCACTNN
+
3A'*)(2%%(%;(&,''-+%%=&%%(*%%%*%'!,
@SRR121577.14 head0094_20091130_2_CD8_M14_15_427_21_3_F3 length=35
ATGCATACGCGGGCCGTAGTCGGTACTCCTCACTC
+
%6'')3*(%.(%&*%+%%%%%%%%'%%(('%%%%&
@SRR121577.15 head0094_20091130_2_CD8_M14_15_427_23_19_F3 length=35
TATGTTATATATTGATGTCAGCGCGCTGCGGCTAT
+
,@4&.1>%?&&?/*(*+(%(%%&%&*%%-'1%+%%
@SRR121577.16 head0094_20091130_2_CD8_M14_15_427_23_82_F3 length=35
TCTGTATTATGGACTACGTGCTATAGCACCACTCG
+
,%'*.()%%%('%%'('%%&(%%%&%%%%%(%)%&
@SRR121577.17 head0094_20091130_2_CD8_M14_15_427_23_1713_F3 length=35
ATGCATACGCATATGTGTAGCGACTCGCAGTGATC
+
%%'&()))*(%)%&%%)&)%%'%%%%(&%%%%%&%
@SRR121577.18 head0094_20091130_2_CD8_M14_15_427_24_17_F3 length=35
TAGTGGCGCGCGGCTACTGTTACAAAAGCATCTAG
+
:<((6,?(=*'>(%%+.%%%%&'%%%(%%(%*/&&
@SRR121577.19 head0094_20091130_2_CD8_M14_15_427_24_1420_F3 length=35
ATGACGCATATAGACGTGAGCGTGCTTACATAGAC
+
'%(%%()()'))%+%)%%%%&%'%%%+&%%%%%%(
@SRR121577.20 head0094_20091130_2_CD8_M14_15_427_25_354_F3 length=35
CTGCTTTGTTTACCTGAGCAAGAAGTTTACCGTGA
+
BBABBBBB=BBBB<BA>@>?@B%1A>?)<?=@>)<
@SRR121577.21 head0094_20091130_2_CD8_M14_15_427_25_1696_F3 length=35
ATGTGCGTATATCGTAGTAGATAGCGTGAGACCGA
+
%9%(&%&'-&()%%%&%%%%%'*%%%%%%%%%*%%
@SRR121577.22 head0094_20091130_2_CD8_M14_15_427_27_116_F3 length=35
TCACATACGCCGGATATCTCGGGTGTTCTGTGATC
+
-8+',&.)((&(,&%)*%%%%%,%(&(&*%**,%,
@SRR121577.23 head0094_20091130_2_CD8_M14_15_427_27_269_F3 length=35
TCATGCGTCGGCCGATTCTTATCGTGACGTCTAGT
+
-,%%)'()%'%'%%%(&%%%%%%%%,%%%%.+%%%
@SRR121577.24 head0094_20091130_2_CD8_M14_15_427_28_43_F3 length=35
AGCATATCTCGTCCAGACTCATAAACCTCATGAGT
+
%>22'7>++%7A;*-<*;9.)/1,(-<&0%();%1
@SRR121577.25 head0094_20091130_2_CD8_M14_15_427_28_58_F3 length=35
TGCAAATGGCTTGGTACCCAACTCTTTCCGGTCTT
+
@-549=0*-B*)2%:)9:6-748<3)&1(9/('03
@SRR121577.26 head0094_20091130_2_CD8_M14_15_427_28_119_F3 length=35
TTCTGCTGCGTAAACGTTCGTGCATTCCCAATCCT
+
>=3)&*%'*%(&*%%,1'&%*)&%).%*%'*%+%)
@SRR121577.27 head0094_20091130_2_CD8_M14_15_427_28_154_F3 length=35
TCTCATAGGCATTCGCTAGATACTGTAAGCAAGAC

Do you see any problem ?? 

 

ADD REPLYlink modified 4.5 years ago • written 4.5 years ago by Veli Kaan Aydin40

Those aren't colorspace reads, I wonder if they tried converting them to base-space (a bad idea) before uploading.

ADD REPLYlink written 4.5 years ago by Devon Ryan88k

Ok I understand that,  thank you :)

ADD REPLYlink written 4.5 years ago by Veli Kaan Aydin40
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1603 users visited in the last hour