Question: Imput files from Refseq database in the program seqret [Emboss]
0
gravatar for JorgeGonzalez
4.4 years ago by
Chile/Concepción/Concepción University
JorgeGonzalez20 wrote:

Hi

I'd like know how I can imput file from Refseq database in the program SEQRET [Emboss], I need imput refseq:NM_004348 file, But there isn´t a option "Refseq database" in databases available  [Input sequence option] . I'm new in this. Do I have to choose other parameters? 

Thank!

 

imput data alignment • 1.3k views
ADD COMMENTlink modified 4.4 years ago by Charles Plessy2.6k • written 4.4 years ago by JorgeGonzalez20
0
gravatar for Charles Plessy
4.4 years ago by
Charles Plessy2.6k
Japan
Charles Plessy2.6k wrote:

If you only have to make a few access, you can skip indexing. Let's assume that you downloaded RefSeq and uncompressed it in a file called human.rna.gbff in your current directory, the command for retrieving the sequence of NM_004348 in FASTA format is seqret human.rna.gbff:NM_004348. Here is an example using the -filter option to send the result to the standard output.

$ seqret -filter human.rna.gbff:NM_004348
>NM_004348 NM_004348 Homo sapiens runt-related transcription factor 2 (RUNX2), transcript variant 3, mRNA.
ggactccaactgggagggggcgccagcgcacccaggacgcggtgccccaagggaccccat
tccaagctgcaaactcaagtcccccgcctccccaggccaaacacacccccgcgcccgttc
gcagctgccaccccgggtgttccaaagactccggcaaagatctgcgcctcccgggtctcc
ctacccgccagcccgactgcgccgcatcgccagactctgttggcccatcagactccgccc
ggcagtcggcctcatcaaacttgatttctcacctcctcagccccatcacctccatcctct
ttccccccgtctcgccttcacccccccaatttcctccttgcccctcatttccaccctcct
ccccctcccccggccacttcgctaacttgtggctgttgtgatgcgtattcccgtagatcc
gagcaccagccggcgcttcagccccccctccagcagcctgcagcccggcaaaatgagcga
cgtgagcccggtggtggctgcgcaacagcagcagcaacagcagcagcagcaacagcagca
(shortened for brievty)

If you need to to access repeatedly to RefSeq records from arbitrary directories, have a look at the manual of the dbxflat command.

RefSeq is available for download from the NCBI's FTP service.

ADD COMMENTlink written 4.4 years ago by Charles Plessy2.6k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1685 users visited in the last hour