Question: Autosomal SNPs tagging sex chromosomes?
0
gravatar for Purpleone
4.8 years ago by
Purpleone90
Australia
Purpleone90 wrote:

Hi,

I've got some human GWAS data and looking at rs7329280 (chr13), which seems to be highly associated with the sex. This doesn't make much sense to me, it's an autosomal SNPs and on UCSC browser there's not much annotated in that region (besides the gene itself, TPTE2).

Is it likely that this SNP is either (1) in long range LD with the sex chromosomes or (2) that the probe sequence has some non-unique binding so it's capturing some sex chromosome region?

I've used blastn to check the sequence (TTCCTTGGACCTCCTAGTCAGGTCACGTAATGACGTTTCTCTGGGAATAA) against human references, the top hits seem to indicate the second option, is that right:

Select seq ref|NC_018924.2|

Homo sapiens chromosome 13, alternate assembly CHM1_1.1

99.6  470 100%  3e-19 100% NC_018924.2
Select seq ref|AC_000145.1|

Homo sapiens chromosome 13, alternate assembly HuRef

99.6  470 100% 3e-19 100% AC_000145.1
Select seq ref|NC_000013.11|

Homo sapiens chromosome 13, GRCh38 Primary Assembly

99.6 531 100%  3e-19  100% NC_000013.11
Select seq ref|NC_000024.10|

Homo sapiens chromosome Y, GRCh38 Primary Assembly

83.8 253 100% 2e-14 96% NC_000024.10

How do people filter these SNPs out, are there lists of known "culprits" somewhere?

ld snp sequence • 1.5k views
ADD COMMENTlink written 4.8 years ago by Purpleone90
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1273 users visited in the last hour