Explanation for strange kmer enrichment at the end of the RNA-seq reads

Question

[lwc628]

One of my RNA seq reads have k mer content looking like below:

The reads have adapter trimmed. But I don't understand why there is a enrichment at the end of the reads. Has anybody seen this?

Answer 1

[Istvan Albert]

The Illumina Indexed TrueSeq adaptor is GATCGGAAGAGCACACGTCTGAACTCCAGTCAC it seems that you have these show up at the end of the reads. The same enrichment will show up multiple times (shifted).