How to interpate information of fastq formate read files ?
2
0
Entering edit mode
8.3 years ago
jack ▴ 960

Hi,

I have read file in Fastq file format. The file format is not well understandable for me.

I looked at first few lines of that, and looks like :

@HISEQ:10:C3B24ACXX:6:2303:18849:17686 2:N:0:ACAGTG
ATCTTCACAAATAAAACAAGCAATTCAATCGATTGATGAAGTATTTGCAAAGGAGAGGAAACATAGGAGTGGAAAAAAAGATGCAGAGTTCAGAT
+
?@?D7DFDHHHFHIIIIIIIIIGGIIIIHDHCB@F9<DD94BG9?DC<<DDFHG@CHE?F;C@AGADHCEIGEE>=;BDFCDCDBB?3(5>:>ACC:>CCD
@HISEQ:10:C3B24ACXX:6:2303:18827:17745 2:N:0:ACAGTG

adinfo@wks-12-49:/MMCI/MS/DeNovoAssembly/work/mirRegression/DE/Data_Martin_lab/140718/Sample_A1$ head -6 A1_ACAGTG_L006_R2_004.fastq
@HISEQ:10:C3B24ACXX:6:2303:18849:17686 2:N:0:ACAGTG
ATCTTCACAACACATAACAAGCAATTCAATCGATTGATGAAGTAAAAGGAGAGGAAACATAGGAGATGTGGAAAAAGATGCAGAGTTCAGAT
+
?@?D7DFDHHHFHIIIIIIIIIGGIIIIHDHCB@F9<DD94BG9?DC<<DDFHG@CHE?F;C@AGADHCEIGEE>=;BDFCDCDBB?3(5>:>ACC:>CCD
@HISEQ:10:C3B24ACXX:6:2303:18827:17745 2:N:0:ACAGTG

Basically what I just understand is that, there is read sequence. what are the others means?

RNA-Seq alignment fasta Assembly • 1.7k views
ADD COMMENT
0
Entering edit mode

Basically every four lines is a new read record.

Line 1: the sequence identifier.

Line 2: The actually DNA sequence.

Line 3: Usually just a + but can contain extra information.

Line 4: The quality represented using ascii character values.

Source: http://en.wikipedia.org/wiki/FASTQ_format

ADD REPLY
1
Entering edit mode
8.3 years ago

Have a read through the wikipedia article. That should clarify things.

ADD COMMENT
1
Entering edit mode
8.3 years ago

It would have been easy to google that out: "fastq" 1. hit https://en.wikipedia.org/wiki/FASTQ_format is quite correct for a start. I recommend the following work-flow for the future:

  • Given you have a question about concept "ABC"
  • Navigate your web-browser to a search engine of your choice (e.g. duckduckgo)
  • Type "ABC" into the search field or simply the URL field of your browser (works most of the time)
  • Press 'Enter'
  • Profit

In short: The meaning of the other lines are quality scores.

ADD COMMENT

Login before adding your answer.

Traffic: 903 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6