Understanding bowtie2 output

Question

[jyu429]

Hi I did local alignment and the output is as below. I'm confused about how to recreate the alignment from this output. Do I look at the CIGAR 1S115M134S and how do I interpret such a thing? Thanks!

H06JUADXX130110:1:1213:20611:8765       16      1-8     174     22      1S115M134S      *        0       0       GAGGCTATGCGCAGAAGTTCCGGGGCAGAGTAACCATGACCAGGGACACCTCCATAAGCACAGCCTACATGGAGTTGAGGAGACTGACATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGGCTCGAGTACAGCAGCAGCCGATAACTACTACTACTACTACTACATGGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCCTCAGGTAAGAATGGCCACTCTAGGGCCTTTCATTTCCCCTACTG      ##########################################################################BAAAAA@@@;=@B@?BABAB=>?;85B?94?B@AABA@@3;>B:@CABBB@A8@@??@<A@@BBACBA8@@ABBAABA@=>A>AAAAA@A@?AAAA??;@BACB??AAABB>@?>@@A8>>@@?@8?AAA@?@@@>>??A>??@>@?@@@@??@>?@???@??????@?@??><@?      AS:i:186        XN:i:0  XM:i:8  XO:i:0  XG:i:0  NM:i:8  MD:Z:9A10A9C12A29C4C2C4G28      YT:Z:UU

Answer 1

[EagleEye]

This explanation will help you understanding it properly: http://genome.sph.umich.edu/wiki/SAM#section_2

You may have heard the term CIGAR, but wondered what it means. Hopefully this section will help clarify it.

The sequence being aligned to a reference may have additional bases that are not in the reference or may be missing bases that are in the reference. The CIGAR string is a sequence of of base lengths and the associated operation. They are used to indicate things like which bases align (either a match/mismatch) with the reference, are deleted from the reference, and are insertions that are not in the reference.

For example:

RefPos:     1  2  3  4  5  6  7  8  9 10 11 12 13 14 15 16 17 18 19
Reference:  C  C  A  T  A  C  T  G  A  A  C  T  G  A  C  T  A  A  C
Read: ACTAGAATGGCT

Aligning these two:

RefPos:     1  2  3  4  5  6  7     8  9 10 11 12 13 14 15 16 17 18 19
Reference:  C  C  A  T  A  C  T     G  A  A  C  T  G  A  C  T  A  A  C
Read:                   A  C  T  A  G  A  A     T  G  G  C  T

With the alignment above, you get:

POS: 5
CIGAR: 3M1I3M1D5M

The POS indicates that the read aligns starting at position 5 on the reference. The CIGAR says that the first 3 bases in the read sequence align with the reference. The next base in the read does not exist in the reference. Then 3 bases align with the reference. The next reference base does not exist in the read sequence, then 5 more bases align with the reference. Note that at position 14, the base in the read is different than the reference, but it still counts as an M since it aligns to that position.

[EagleEye]

Look into page number 5 from this PDF: http://samtools.github.io/hts-specs/SAMv1.pdf

M  alignment match (can be a sequence match or mismatch)
I   insertion to the reference
D   deletion from the reference
N   skipped region from the reference
S   soft clipping (clipped sequences present in SEQ)
H   hard clipping (clipped sequences NOT present in SEQ)
P   padding (silent deletion from padded reference)
=  sequence match
X  sequence mismatch

[jyu429]

Thanks so much!

[jyu429]

Do the numbers in front of the letters mean how many times the operation occurred? How do I know what positions they occurred at though?