toosl to find motifs which are snp-specific

Question

[Zhilong Jia]

To find the functionality of A SNP, I'd want to find a tool that can find a kind of SNP-specific motif. The SNP-specific motif means this motif binds one allele of SNP strongly but not the other. Thank you.

Answer 1

[UnivStudent]

Your can use the scan two sequences for differential TF binding tool from Cis-BP. Just choose the species' motifs that you want to scan and put in sequences surrounding your SNP of interest.

[Zhilong Jia]

That's exactly the tool I seek. but for long sequence, the server is dead. By the way, Is there any other tools like this? Thank you.

example: (from human)

TGTGTGTAAGACATGCAGTCAACAATGAGATGAAGGCCATTGCATAGATCT and TGTGTGTAAGACATGCAGTCAACAACGAGATGAAGGCCATTGCATAGATCT.

[UnivStudent]

I don't think it's dead. I just tried it with that example and it works. Also you might want to try it with shorter sequences (SNP and 10-15bp on either side) to avoid it timing out on you, and because most binding sites are only 8 ntds long so much more and you'd be scanning more sequence than you need to (e.g the 25 ntd on either side)

[Zhilong Jia]

You are right. with the tick of SNP Scan box, it works.