Question: toosl to find motifs which are snp-specific
0
gravatar for Zhilong Jia
4.0 years ago by
Zhilong Jia1.4k
London
Zhilong Jia1.4k wrote:

To find the functionality of A SNP, I'd want to find a tool that can find  a kind of SNP-specific motif. The SNP-specific motif means this motif binds one allele of SNP strongly but not the other. Thank you.

snp motif • 1.4k views
ADD COMMENTlink modified 3.8 years ago by UnivStudent380 • written 4.0 years ago by Zhilong Jia1.4k
0
gravatar for UnivStudent
3.8 years ago by
UnivStudent380
Canada
UnivStudent380 wrote:

Your can use the scan two sequences for differential TF binding tool from Cis-BP. Just choose the species' motifs that you want to scan and put in sequences surrounding your SNP of interest.

 

ADD COMMENTlink written 3.8 years ago by UnivStudent380

That's exactly the tool I seek. but for long sequence, the server is dead. By the way, Is there any other tools like this? Thank you.

example: (from human)

TGTGTGTAAGACATGCAGTCAACAATGAGATGAAGGCCATTGCATAGATCT and TGTGTGTAAGACATGCAGTCAACAACGAGATGAAGGCCATTGCATAGATCT.

ADD REPLYlink written 3.8 years ago by Zhilong Jia1.4k

I don't think it's dead. I just tried it with that example and it works. Also you might want to try it with shorter sequences (SNP and 10-15bp on either side) to avoid it timing out on you, and because most binding sites are only 8 ntds long so much more and you'd be scanning more sequence than you need to (e.g the 25 ntd on either side)  

ADD REPLYlink written 3.8 years ago by UnivStudent380

You are right. with the tick of SNP Scan box, it works.

ADD REPLYlink written 3.8 years ago by Zhilong Jia1.4k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1841 users visited in the last hour