Question: What's the meaning of Tags generated by stampy
0
gravatar for Cherry
4.5 years ago by
Cherry50
Germany
Cherry50 wrote:

Hello everyone!

I am confused with the tags in sam files generated by stampy.

I have checked the documents of stampy and it said that:

"Stampy computes posteriors and likelihoods both for pairs of reads, and for reads considered by themselves. The following table summarizes the SAM tags for these statistics for paired reads:

	  Read                     | Posterior   | Likelihood |
	  -------------------------+-------------+------------+
	  Pair                     | MAPQ column | PQ:i:      |
	  This read as single read | SM:i:       | UQ:i:      |
	  Mate as single read      | MQ:i:       | XQ:i:      |

"

and I got the results after mapping with stampy:

SRR******    99      chr1 40831563        99      100M    =       40831976        513     CTCCTTAGGTGTTAATTCCTTCCGGAGATAATCTATTATCTTTCCCTTCAAAAAAAAAAAAGATTGAGAGGTTTAAATCTCCCAATCCAATATTCGAGAG     @@@=DFDDHFHHHIIEIIIEHIIIH8E@FHEHAFFHEHIEHIIGGGGGHIIGAFHIIFCB688@CC>@AC@C<:?4@A:3>CCCCCC?(:>>ACD?AC?B     PQ:i:18 SM:i:58 UQ:i:0  MQ:i:96 XQ:i:0  NM:i:0
SRR******    147     chr1 40831976        99      100M    =       40831563        -513    AGCAAAATCCTGTACTGCCGCGCCACCTCTGTATCGGTGATTAGGATATCATCACCTAACAGGGCGTAATCAGCAAAAGGGGTAGTACTCGTTGGGTATG     ##@B@>:BBEBBB@B<BB@B??=?@@@6@@BB8:DIIEFGFCGEF@<<B8.88*EF@FDIGFFFEACIEIIFFDFIFFFEFFFIFGA@+A1FD?DDD@@@     PQ:i:18 SM:i:96 UQ:i:0  MQ:i:58 XQ:i:0  NM:i:0
SRR******    99      chr1 25433105        18      100M    =       25433519        514     AGTTAAGTAGTTCTATGCAACAGCAAAGTATAAAATAATTCTGGCAGCGTGGGCAAGACGTTGTATCACCACTTAGGCTCATAGTAGTGGTTGTCGGTTA  @@BDFFFDHHHGHJJIIIIJJJIIJJJHFHIJJJJJJJJJJJJJJIIGIDHIIGIIHJJIHEGCDGHEHHHHFFFFFDDEEEEDDDCFDD@?DDDDDB9B     PQ:i:512        SM:i:0  UQ:i:346        MQ:i:96  XQ:i:196        NM:i:9

 

My questions are

1)which col is mapping quality? Is it col 5 or col PQ:i? 

2)If I want to call SNPs next,I usually used XT tag to filter reads first after mapping with bwa, but how should I do now? Is it right to filter the reads with the mapping quality higher than 30 and properly paired at the same time using SAMtools?

If I have any misunderstanding, please tell me. Thanks a lot! 

sequencing next-gen • 1.4k views
ADD COMMENTlink modified 4.4 years ago by Biostar ♦♦ 20 • written 4.5 years ago by Cherry50
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1952 users visited in the last hour