Hi.
I am struggling to want using Socrates. (http://bioinf.wehi.edu.au/socrates/)
I looked up its web pages and followed the procedure written in it.
However, when I tried to run the second step called "realignment process", program show me warning message
and I suppose that this warning message might be affect my final results.
Below is my warning message.
./Socrates realignment filteredresults_long_sc_l25_q5_m5_i95.fastq.gz out3.bam --bowtie2_db filteredresults_long_sc_l25_q5_m5_i95.fasta
Bowtie2 alignment, DB=filteredresults_long_sc_l25_q5_m5_i95.fasta
115 reads; of these:
115 (100.00%) were unpaired; of these:
11 (9.57%) aligned 0 times
83 (72.17%) aligned exactly 1 time
21 (18.26%) aligned >1 times
90.43% overall alignment rate
Add anchor information into re-alignment BAM file
input BAM file: -
output BAM file: out3.bam
WARNING: 115 alignments with no matching reference chromosome name
in realignment BAM's sequence dictionary. Please ensure the same alignment indexes
are used for both raw read alignment and soft-clip realignment.
I think that Socrates was developed in 2014 and many people do not use it
,However, Is someone who already used it and got the final results,
Could you help me and advise for my problem?
SAM/BAM files have what's called a header. This header contains, among other things, information about all of the contig names in the FASTA file which was used as the reference for the alignment. Below is a (very short) example of a FASTA file. The header is the first line, in bold type:
You can view the header of a BAM file using samtools:
samtools view -H [my.bam]
I suspect the problem here is that there is some disagreement between the FASTA reference and one or more of the output files. For starters, can you please tell us the output of the above command when run on each of the output BAM files, and the output of this command?:
grep '^>' [reference.fasta]
It might also be helpful to add the results of this command:
samtools view -h [example.bam]
so we can see the first few lines of the BAM file.
Firstly below is my command for running Socrates.
In this way, I ran Socrates and below is the first few lines of my input and output files as you mentioned.
1. grep '^>' filteredresults_long_sc_l25_q5_m5_i95.fasta
>DJG84KN1:246:C0VTVACXX:8:2216:14706:73242/2&chr14&19486038&-&1&TCAAAGCCTTGATCTCTTCTTTTTCAGGTACCTGATGCCT
>DJG84KN1:246:C0VTVACXX:8:1212:19548:4085/2&chr14&19489007&-&0&ATATTTGCTGACAGGTGTATCTGCGTTTCCCTCTGAGGACATCACTGAAATCATGGAACCCTTAT
>DJG84KN1:246:C0VTVACXX:8:1309:21210:96438/2&chr14&19489007&-&0&ATATTTNCNGACAGGTGTATCTGCGTTTCCCTCTGAGGACATCACTGAAA
>DJG84KN1:246:C0VTVACXX:8:1112:21154:15113/2&chr14&19489041&-&0&GAGGACATCACTGAAATCATGGAANCCTTATGTTCACTGACCG
>DJG84KN1:246:C0VTVACXX:8:1302:21219:46823/2&chr14&19490615&-&0&CGTGAAAGATTACCAAAGAGAANGNCATATATTTAGCAGATCAGTTAATAGACAAAAGTCAACTTT
2. /DATA2/sclee1/samtools-0.1.19/samtools view -h out3.bam
@HD VN:1.0 SO:coordinate
@SQ SN:DJG84KN1:246:C0VTVACXX:8:2216:14706:73242/2&chr14&19486038&-&1&TCAAAGCCTTGATCTCTTCTTTTTCAGGTACCTGATGCCT LN:53
@SQ SN:DJG84KN1:246:C0VTVACXX:8:1212:19548:4085/2&chr14&19489007&-&0&ATATTTGCTGACAGGTGTATCTGCGTTTCCCTCTGAGGACATCACTGAAATCATGGAACCCTTAT LN:28
@SQ SN:DJG84KN1:246:C0VTVACXX:8:1309:21210:96438/2&chr14&19489007&-&0&ATATTTNCNGACAGGTGTATCTGCGTTTCCCTCTGAGGACATCACTGAAA LN:43
@SQ SN:DJG84KN1:246:C0VTVACXX:8:1112:21154:15113/2&chr14&19489041&-&0&GAGGACATCACTGAAATCATGGAANCCTTATGTTCACTGACCG LN:50
@SQ SN:DJG84KN1:246:C0VTVACXX:8:1302:21219:46823/2&chr14&19490615&-&0&CGTGAAAGATTACCAAAGAGAANGNCATATATTTAGCAGATCAGTTAATAGACAAAAGTCAACTTT LN:27
Finally, one thing that I suspect is that I used for input bam file was made by using bwa aligner, however,
the output bam files might be made up of using bowtie2. This mismatch could be warning message?
It is just my guess.
Thank you for your helping and look forward to seeing your answer :)