Question: mirdeep2: miRDeep.pl error
0
gravatar for galina_ananina
3.8 years ago by
Brazil
galina_ananina0 wrote:

I wonder if somebody knows how many different (not concatenated) samples can be analyzed with miRDeep.pl module of mirdeep2 package. I have some troubles to analyze more than 2 samples. After preparing reads_collapsed.fa (-m option to collapse reads applied) e reads_vs_genome.arf applying config-file e mapper.pl module for 12 samples, I've got an error running miRDeep.pl: repeated sequencies in the reads_collapsed.fa.

=========
The sequence
TGTAAACATCCTCGACTGGA
occures at least twice in sample XXX in your reads file
=========

Why does it happen? Did the collapsing failed?

next-gen software error • 1.5k views
ADD COMMENTlink written 3.8 years ago by galina_ananina0

Have you solved this problem?

ADD REPLYlink written 17 months ago by fana0
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1936 users visited in the last hour