reads mapped in proper pair (99/147) but mapq=0 ?
0
0
Entering edit mode
7.0 years ago

Here are two reads mapped in proper pair with bwa 7.10. (+recalibration + realign around indels). How can I explain  this MAPQ= '0' ?

HWI-1KL149:89:HA4T6ADXX:2:1114:12983:47552    99    1    146992 0    150M    =    147235    393 CACTTCAGCCTGGGTGACAGAGCCAGACCATGTCACAAAAAGTTAGAAAAAAAAAAGAGA
GAGGGAGAGAGACTATACACAGGCACCACCACATTTGGCTAATTTTTAAATATTCTGTAGAGACAAGGTCTTGCTAGGTTGCCCAGGCTA @B?BCEGGHFGFDCDFCBDACDEBDCCDCDCECCDCDDDDCECBCDDBACDDDCDD=?@AAAHG@DGDHDHEGFAD
CADGCGGHDFHEGHEGEEEEGAHFCBCEEDECEEECEEHEDCCHDHEGEEAF?CDDBCCC@ACEA@BCCA<@A< MC:Z:150M BD:Z:LLLNLMNPPNOONKOLOOKNNNOMNONNNNNNJNLKKLDDDMNLHMMMDDDDDDDDMNNNNMMMIMMNMLM
MNNMLMMKLKONMOLNMLNNLKNLDMMMNMLMLDDDHLDMMMLMNNKMMNNOMJMNONMMMMNNMMNNLMNMJOPNMNM MD:Z:150    RG:Z:p190 BI:Z:QQORQTNSSOSSSMSPSRMRPOSNSSQQRSQSPRNONQIIIRQRQRQRHHHHHHI
IRQOPOPPQLSPQPQPQRRRQQQNONSQOSORSORSONQPNRROSRPRPNNNQPIRQQPSRQOQPPOPRNPQPRQRQRRSRRQSQRRNQSSQOSR NM:i:0    MQ:i:0    AS:i:150    XS:i:150
HWI-1KL149:89:HA4T6ADXX:2:1114:12983:47552    147    1    147235 0    150M    =    146992    -393 GGAGTTCGAGACCAGCCTGGCCAACACGGTGAAACTCTGACTCTATCAAAAATACAAAAA
TCAGCTGGGCAGTAGTGGCGTGTGCCTGTAGTCTCACCTACTCGGGAGGCTGAGGCAGGAGAATCACTTGAACCTGGGAGGTGGAGGTTG @A?BAB6>;BCGFFDA=DC@7AE@A?=CBC@B@?HBHEGCABACB<GBCEEEBCGEEEEC?BFC=DBHBFD@AFGE
GE@EEEEBCDDCDCFDACFCDFACFDCBBFCADDCDDBCDCADBCCCCFDFDDECBBAFBCFCEEEGGBGC=@? MC:Z:150M BD:Z:NNNLMMKNNNNMNNLNONMMMMLKKLMNLMMDLNNNOMMNNNMMMNMDDCLMMKLDDDLMNNNOONIMNNN
MMLLNMLLLKLOMNOKMMNNNNNKNKMMNNMMINNNMOOMMMMMNNNMNNMMNKONMMMJMOPOJOOOOMOOONMLLLL MD:Z:150    RG:Z:p190 BI:Z:SRRQRRRRRRSRRSOQSSNORRRPPQRRONSNRRPQSNQPNPQPQRQNNNPQRPR
NNNPRSRSSSSPMRRRQRROSNQQONNROPRLOPQQPORORQRPRPRRQSRRNSSNRRNRRRSRRSPRSPRQQNSRSRTTRTSSSPTSQRRQQQQ NM:i:0    MQ:i:0    AS:i:150    XS:i:150

read mapq bam • 2.1k views
ADD COMMENT
1
Entering edit mode

Is it not a multi mapped read ?

ADD REPLY
0
Entering edit mode

could be, I blatted the 1st sequence:

---------------------------------------------------------------------------------------------------
browser details YourSeq          150     1   150   150 100.0%     5   -  180740198 180740347    150
browser details YourSeq          150     1   150   150 100.0%     3   -  197934503 197934652    150
browser details YourSeq          150     1   150   150 100.0%     1   +     146992    147141    150
browser details YourSeq          149     1   150   150 100.0%     4   +  120344206 120344359    154
browser details YourSeq          149     1   150   150 100.0%     1   +  243233489 243233642    154
browser details YourSeq          149     1   150   150 100.0%     1   +  222666022 222666175    154
browser details YourSeq          148     1   150   150  99.4%    19   +     212368    212517    150
browser details YourSeq          148     1   150   150  98.0%    11   +     142059    142207    149
browser details YourSeq          146     1   150   150  99.4%     7   -  128278189 128278345    157
browser details YourSeq          146     1   150   150  99.4%    16   -   90221744  90221893    150
browser details YourSeq          145     1   150   150  95.9%     1   +     682682    682827    146
browser details YourSeq          143     1   150   150  98.0%     1   +  224152894 224153048    155
browser details YourSeq          142     1   150   150  98.0%     7   -   45834042  45834191    150
browser details YourSeq          142     1   150   150  98.0%     4   -  119538519 119538668    150
browser details YourSeq          142     1   150   150  99.4%    10   -   38723425  38723575    151
browser details YourSeq          132     1   149   150  95.3%     7   +   51473634  51473794    161
browser details YourSeq          131     1   149   150  95.3%     7   -   39818221  39818388    168
browser details YourSeq          130     1   149   150  94.6%     7   +   56459438  56459599    162
browser details YourSeq          118     1   149   150  94.1%     7   -   65289482  65289689    208
browser details YourSeq          114     7   149   150  93.8%     7   +   55829219  55829373    155
browser details YourSeq          104     8   149   150  88.9%    18   -   14725111  14725269    159
(...)
ADD REPLY
0
Entering edit mode

how were the reads mapped?
if tophat was used, the mapping quality refers to the number of times a read maps to different locations on the genome (MAPQ==0: more than 5 mapping sites, I think)

ADD REPLY
0
Entering edit mode

it was mapped bwa 7.10

ADD REPLY
1
Entering edit mode

then see: What Does The Zero Mapping Quality Mean For The Bwa Mapper?

it is for general multi-mapping

ADD REPLY
0
Entering edit mode

OK, seems to be a multi-mapped read. I expected to find a flag/property about this in the reads. I'll validate the 1st answer about this :-)

ADD REPLY
2
Entering edit mode

AS:i:150 and XS:i:150 => second best hit has the same score as the best hit.

ADD REPLY

Login before adding your answer.

Traffic: 2565 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6