Question: Problem about Samtools Mpileup
gravatar for wangyang703092
5.8 years ago by
wangyang70309290 wrote:

I have been generating consensus sequences from a Bowtie2-aligned BAM file using the following script:

samtools mpileup  -d 100000 -Q 0 -q 0 -f Reference.fasta input.bam

in the pileup file, the consensus sequence has a gap where I can clearly see reads that map to the reference,

in the pileup file,there is a gap between 42449 and 42469

Supercontig_1.1 42441   T       10      ,$..,,...,,     EIDIH@G6DI
Supercontig_1.1 42442   A       9       .$.,,...,,      DEIHBI6AI
Supercontig_1.1 42443   C       8       .,,...,,$       EIH>I5GE
Supercontig_1.1 42444   A       7       .$,$,...,       EEH@EAG
Supercontig_1.1 42445   T       5       ,$...,  EADEH
Supercontig_1.1 42446   G       4       ...,    AEEH
Supercontig_1.1 42447   G       4       .$.$.,  BBAH
Supercontig_1.1 42448   C       2       .,      <G
Supercontig_1.1 42449   T       2       .$,$    8E
Supercontig_1.1 42469   C       2       ^",^",  EA
Supercontig_1.1 42470   T       3       ,,^".   >?E
Supercontig_1.1 42471   G       4       ,,.^",  FBFB
Supercontig_1.1 42472   G       5       ,,.,^". E=FAE

in the sam file,there exists alignments:(part of them):

N57638:1:64U4YAAXX:1:5:19405:8167       355     Supercontig_1.1 42376   2       76M     =       42580   280     CACTGGACGAAGGATACGCGTCACTGACAGTACCTTGCCACCGAAGAATTGAGTTCACGGACGACTACATGGCTGA    IIIIIIHIIHHHIIDIIHHFIIDIIIIBIIFIDIHEHIIIHIIHFFHHGHIFBDGEFEIE@CEBEFHDGEDGBEFH    AS:i:-10        XS:i:-10        XN:i:0  XM:i:2  XO:i:0  XG:i:0  NM:i:2  MD:Z:49C25C0    YS:i:-30        YT:Z:CP
N57638:1:64U4YAAXX:4:16:18415:14633     355     Supercontig_1.1 42376   6       76M     =       42672   372     CACTGGACGAAGGAAACGCGTCACTGACAGTACCTTGCCACCGAAGAATCGAGTTCACGGACGACTACATGGCTGA    IIIFIIIIGIEIIIIHIDIIIIDIIIHDHIFHIHIBIHIIIEIDIHHHHEIGHGIGDED<BEC8>ECEBB,@A?@D    AS:i:-11        XS:i:-11        XN:i:0  XM:i:2  XO:i:0  XG:i:0  NM:i:2  MD:Z:14T60C0    YS:i:-16        YT:Z:CP
N57638:1:64U4YAAXX:2:19:4746:19217      16      Supercontig_1.1 42377   1       60M     *       0       0       ACTGGACGAAGGATACGCGTCACTGACAGTACCTTGCCACCGAAGAATTGAGTTCACGGA    A-C;C98;52B;2?67/.72:-4;7<:4429@=?@>1=9=;=?=@77844=<=BB??B?B    AS:i:-3 XS:i:-3 XN:i:0  XM:i:1  XO:i:0  XG:i:0  NM:i:1  MD:Z:48C11      YT:Z:UU
N57638:1:64U4YAAXX:3:78:11945:7264      339     Supercontig_1.1 42378   12      76M     =       42087   -367    CTGGACGAAGGAAACGCGTCACTGACAGTACCTTGCCACCGAAGAATCGAGTTCACGGACGACTACATGGCTGACA    5;7?7<E>>@BCC>EEB@<B<<BDABBGFAECAAAAFB@FGHHGHHFGGEGGBG@GGGGGG@HHHHHHHHHHHHDH    AS:i:-15        XS:i:-15        XN:i:0  XM:i:3  XO:i:0  XG:i:0  NM:i:3  MD:Z:12T60C0A1  YS:i:0  YT:Z:CP
N57638:1:64U4YAAXX:3:46:17100:16602     419     Supercontig_1.1 42379   7       76M     =       42666   342     TGGACGAAGGATACGCGTCACTGACAGTACCTTGCCACCGAAGAATTGAGTTCACGGACGACTACATGGCTGACAA    IIIGHIHIIIIIIIIIEGIIIIIHGI=IIIBIIIIBIIIIGIGIFIIHDDEFGIIIIFIIHGFIIIGDDHE@DEHH    AS:i:-16        XS:i:-16        XN:i:0  XM:i:3  XO:i:0  XG:i:0  NM:i:3  MD:Z:46C25C0A2  YS:i:-12        YT:Z:CP
N57638:1:64U4YAAXX:3:82:4520:20210      355     Supercontig_1.1 42379   0       76M     =       42599   296     TGGACGANGGAAACGCGTCACTGACAGTACCTTGCCACCNAAGAATCGAGTTCACGGACGACTACATGGCTGACAA    IIHIIFC#ECCEEEEHIIIIIHIFIIIEIIIIIIIDDDD#>>???@EEEE@@DBEFBEDB@ADEADDDAAABB@B5    AS:i:-17        XS:i:-17        XN:i:0  XM:i:5  XO:i:0  XG:i:0  NM:i:5  MD:Z:7A3T27G32C0A2      YS:i:-33        YT:Z:CP
N57638:1:64U4YAAXX:4:101:2199:9982      355     Supercontig_1.1 42379   7       76M     =       42571   268     TGGACGAAGGATACGCGTCACTGACAGTACCTTGCCACCGAAGAATTGAGTTCACGGACGACTACATGGCTGACAA    IIIIIIIIIIIIIIHIIIIIIIIHIIIIGIIIIIIIIIIIHIIIIIIIDIGIIIIHIIIIHHIIHHHHGIIEIGHB    AS:i:-17        XS:i:-17        XN:i:0  XM:i:3  XO:i:0  XG:i:0  NM:i:3  MD:Z:46C25C0A2  YS:i:-22        YT:Z:CP

Does anyone know why this happened,thanks!

snp samtools assembly • 2.4k views
ADD COMMENTlink modified 5.4 years ago by Biostar ♦♦ 20 • written 5.8 years ago by wangyang70309290
gravatar for Devon Ryan
5.8 years ago by
Devon Ryan97k
Freiburg, Germany
Devon Ryan97k wrote:

None of the example alignments would change the results you showed. Secondary alignments will always be ignored and the only alignment from the examples ends at positions 42436.

ADD COMMENTlink written 5.8 years ago by Devon Ryan97k

Thanks,but why you said the alignments will always be ignored,aren't the reads mapped to the region between 42449 and 42469? I am new to mpileup. 在2015年01月05日 23:58,Devon Ryan on Biostar 写道: Activity on a post you are following on Biostar

User Devon Ryan wrote Comment: Problem about Samtools Mpileup:

None of the example alignments would change the results you showed. Secondary alignments will always be ignored and the only alignment from the examples ends at positions 42436.

You may reply via email or visit C: Problem about Samtools Mpileup

ADD REPLYlink written 5.8 years ago by wangyang70309290

All but one of those are secondary alignments. Given that the main use of mpileup is in variant calling, secondary alignments are ignored by default (note the --ff options defaults).

ADD REPLYlink written 5.8 years ago by Devon Ryan97k

Sorry Devon, what's secondary alignments, and where is the --ff option(in bowtie2?) 在2015年01月06日 00:18,Devon Ryan on Biostar 写道: Activity on a post you are following on Biostar

User Devon Ryan wrote Comment: Problem about Samtools Mpileup:

All but one of those are secondary alignments. Given that the main use of mpileup is in variant calling, secondary alignments are ignored by default (note the --ff options defaults).

You may reply via email or visit C: Problem about Samtools Mpileup

ADD REPLYlink written 5.8 years ago by wangyang70309290

--ff is a samtools mpileup option. A secondary alignment is defined in the SAM specification.

ADD REPLYlink written 5.8 years ago by Devon Ryan97k

Thanks for your patience,I would like to use the secondary alignments to call SNP, how can I set the mpileup options.When I read the manual, I haven't find the --f option 在2015年01月06日 00:47,Devon Ryan on Biostar 写道: Activity on a post you are following on Biostar

User Devon Ryan wrote Comment: Problem about Samtools Mpileup:

ADD REPLYlink written 5.8 years ago by wangyang70309290

Hi,i found that --ff is a filter option,but it can only accept INT ,i don't know how to set that,do you have any idea?

ADD REPLYlink written 5.8 years ago by wangyang70309290

At least the version I have also allows a (presumably comma separated) string, but the integer representation of what I would presume you want is 1540 (UNMAP 4, QCFAIL 512, DUP 1024). That would then ignore unmapped reads and those marked as duplicates or as having failed quality control.

ADD REPLYlink written 5.8 years ago by Devon Ryan97k

I did what you told me, my command is samtools mpileup --ff 1540 -f aaa.fasta aln.bam, but it has no difference with the result without --ff option. So i download the lastest version samtools-1.1 and bcftools-1.1, when using -ff 1540 or string[UNMAP,QCFAIL,DUP], it does work! Firstly, i used bcftools view to do the consensus calling, it went wrong, then i found bcftools call is the former bcftools view, the question is that what is the equal command to "bcftools view -cg" in bcftools call

ADD REPLYlink modified 5.8 years ago by Devon Ryan97k • written 5.8 years ago by wangyang70309290

Glad that fixed things for you.

ADD REPLYlink written 5.8 years ago by Devon Ryan97k

Do you know how to set the bcftools call options because i'm not familiar to it. I used bcftools view -cg before, and now i use bcftools call -c ,do you think it's correct?

ADD REPLYlink modified 5.8 years ago • written 5.8 years ago by wangyang70309290

bcftools call -c would seem correct.

ADD REPLYlink written 5.8 years ago by Devon Ryan97k

Thank you so much for your help

在2015年01月06日 17:50,Devon Ryan on Biostar 写道: Activity on a post you are following on Biostar

User Devon Ryan wrote Comment: Problem about Samtools Mpileup:

bcftools call -c would seem correct.

You may reply via email or visit C: Problem about Samtools Mpileup

ADD REPLYlink written 5.8 years ago by wangyang70309290
Please log in to add an answer.


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1141 users visited in the last hour