Question: Tophat Error : Couldn't build bowtie index with err = 1
0
gravatar for sbdk82
4.2 years ago by
sbdk8240
United States
sbdk8240 wrote:

I used the following command to run tophat 

tophat    -G $RPATH/ED.gtf    -o $RPATH/tophat/E1    $RPATH/bowtie/ED    ..../E1_L5.fastq, $RPATH/.../E1_L6.fastq

and I am getting the following error. If I remove GTF file from the command, it is running perfectly without any error.

[2015-01-10 16:10:40] Beginning TopHat run (v2.0.12)
-----------------------------------------------
[2015-01-10 16:10:40] Checking for Bowtie
                  Bowtie version:        2.2.2.0
[2015-01-10 16:10:40] Checking for Samtools
                Samtools version:        0.1.19.0
[2015-01-10 16:10:40] Checking for Bowtie index files (genome)..
[2015-01-10 16:10:40] Checking for reference FASTA file
        Warning: Could not find FASTA file .../bowtie/ED.fa
[2015-01-10 16:10:40] Reconstituting reference FASTA file from Bowtie index
  Executing: /util/opt/bowtie/2.2/bowtie2-inspect .../bowtie/ED > .../tophat/E1/tmp/ED.fa
[2015-01-10 16:10:41] Generating SAM header for .../bowtie/ED
[2015-01-10 16:10:42] Reading known junctions from GTF file
[2015-01-10 16:10:43] Preparing reads
         left reads: min. length=100, max. length=100, 14298526 kept reads (1494 discarded)
[2015-01-10 16:19:24] Building transcriptome data files .../tophat/E1/tmp/ED
[2015-01-10 16:19:24] Building Bowtie index from ED.fa
        [FAILED]
Error: Couldn't build bowtie index with err = 1
bowtie rna-seq tophat • 12k views
ADD COMMENTlink modified 2.7 years ago by SpreeFU0 • written 4.2 years ago by sbdk8240
1
gravatar for RamRS
4.2 years ago by
RamRS20k
Houston, TX
RamRS20k wrote:

bowtie is looking for the reference FASTA file in the same directory that the GTF file is located in (and with the same name). Please check if you've addressed that requirement in your setup.

ADD COMMENTlink written 4.2 years ago by RamRS20k
1
gravatar for AidanQuinn
3.7 years ago by
AidanQuinn20
United States
AidanQuinn20 wrote:

I had the same problem today using the comprehensive gene annotation GTF from GENCODE and the Illumina pre-build genome. The file names were not the problem but the chromosome names were annotated differently in the GTF and the genome (*.fa) files. The GTF annotation for chromosomes was "chr#" and the Illumina genome annotation was "#" (where # is the chromosome number).

You can fix this by either using a different genome, that has the "chr#" annotation or I just removed the 'chr' from my GTF with sed as follows:

sed 's/^chr//g' annotation.gtf > annotation.2.gtf

That worked pretty well for me. Hope this helps.

ADD COMMENTlink written 3.7 years ago by AidanQuinn20
0
gravatar for sbdk82
4.2 years ago by
sbdk8240
United States
sbdk8240 wrote:

I have ED.fasta (not .fa) and ED.gtf in the same directory, not in ../bowtie/ directory. I first used bowtie-index to create the index using this

 bowtie2-build  -f ED.fasta  ../bowtie/ED

 

ADD COMMENTlink written 4.2 years ago by sbdk8240

Check if bowtie has an option to explicitly specify the name of the reference fasta file. Also, could you please move this to a comment on my answer?

ADD REPLYlink written 4.2 years ago by RamRS20k
0
gravatar for Azhar
3.9 years ago by
Azhar40
China
Azhar40 wrote:

Hi,

I am facing this problem and using ssh can any body help me i am new to ti

Error: Encountered internal Bowtie 2 exception (#1)
Command: bowtie2-build genome.fasta index

 

ADD COMMENTlink modified 3.9 years ago by RamRS20k • written 3.9 years ago by Azhar40

Please edit your post and add the command you used. 

ADD REPLYlink written 3.9 years ago by RamRS20k
0
gravatar for Mehmet
3.9 years ago by
Mehmet460
Japan
Mehmet460 wrote:

first,

bowtie2-build sample.fa sample

which will give you index file. keep the index files in the same directory. then, change name of your genome file (fast file) as "sample". Then, use your sample file without .fa extension. just write "sample" in tophat command. i think this works.

ADD COMMENTlink written 3.9 years ago by Mehmet460
0
gravatar for SpreeFU
2.7 years ago by
SpreeFU0
SpreeFU0 wrote:

Hi all,

here is my genome

1 CCCTAAACCCTAAACCCTAAACCCTAAACCTCTGAATCCTTAATCCCTAAATCCCTAAAT CTTTAAATCCTACATCCATGAATCCCTAAATACCTAATTCCCTAAACCCGAAACCGGTTT CTCTGGTTGAAAATCATTGTGTATATAATGATAATTTTATCGTTTTTATGTAATTGCTTA TTGTTGTGTGTAGATTTTTTAAAAATATCATTTGAGGTCAATACAAATCCTATTTCTTGT GGTTTTCTTTCCTTCACTTAGCTATGGATGGTTTATCTTCATTTGTTATATTGGATACAA GCTTTGCTACGATCTACATTTGGGAATGTGAGTCTCTTATTGTAACCTTAGGGTTGGTTT

here is my annotation

gff-version 2

bed_to_gff_converter.py

1 bed2gff At1NC000010 797 1343 0 + . At1NC000010; 1 bed2gff At1NC000020 2498 2816 0 - . At1NC000020;

but I still have the same error Error: Couldn't build bowtie index with err = 1

Please help me to fix this. Thanks a lot!

ADD COMMENTlink written 2.7 years ago by SpreeFU0
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 834 users visited in the last hour