Question: Remove Illumina TruSeq Index adapters
3
gravatar for enricoferrero
5.9 years ago by
enricoferrero800
United Kingdom
enricoferrero800 wrote:

Hi,

I'm analysing data from a multiplexed RNA-seq experiment where the library was generated using the Ilumina TruSeq Universal Adapter and the Illumina TruSeq Index Adapters (see page 12 of this letter from Illumina).

From the FastQC report I can see a slight adapter contamination and I'd like to remove all adapters from the FASTQ files before progressing with the analysis. I'm using Scythe ( https://github.com/vsbuffalo/scythe ), which needs the adpater sequences in FASTA format. This is my FASTA file:

>TruSeq_Universal_Adapter
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
>TruSeq_Universal_Adapter_RC
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT
>TruSeq_Index_Adapter
GATCGGAAGAGCACACGTCTGAACTCCAGTCAC
>TruSeq_Index_Adapter_RC
CAAGCAGAAGACGGCATACGAGAT

My questions are:

  1. For the index adapter, I'm using the invariable part of the sequence at the 5'- end of the 6 bases-long barcode (TruSeq_Index_Adapter) and the reverse complement of the sequence at the 3'- end of the 6-bases-long barcode (TruSeq_Index_Adapter_RC). Is this correct?
  2. Do I need to include the adapters' reverse complements at all or this is already taken care of when specifying the forward sequence?

Thanks!

 

ADD COMMENTlink modified 13 months ago by milad eidi0 • written 5.9 years ago by enricoferrero800

Hello Enrico!

It appears that your post has been cross-posted to another site: SEQanswers.

This is typically not recommended as it runs the risk of annoying people in both communities.

ADD REPLYlink written 5.9 years ago by Devon Ryan97k

Hi Devon,

Sorry, I had no idea this was an issue! Should I remove the SEQanswers one?

ADD REPLYlink written 5.9 years ago by enricoferrero800

I'm not sure that you can. Just keep that in mind in the future.

ADD REPLYlink written 5.9 years ago by Devon Ryan97k

I have same question as OP; Thus: What would be the post on SEQanswers?

ADD REPLYlink written 3.3 years ago by unksci160

I am looking for answers to the same question but not able to find this question at SEQanswers. Can you direct me to the post?

ADD REPLYlink written 13 months ago by mnazir0

Here is the letter with Illumina adapter sequences.

ADD REPLYlink written 13 months ago by genomax92k
0
gravatar for ngsgene
5.9 years ago by
ngsgene350
United States
ngsgene350 wrote:

If I am correct there's something about Scythe and 5'- end, you may want to check out their readme.

This post explains the thumb rule of trimming adaptors Is It Necessary To Remove Adapters In All Orientations When Preprocessing Ngs Data?  worth a look.

ADD COMMENTlink written 5.9 years ago by ngsgene350
0
gravatar for boczniak767
13 months ago by
boczniak767690
Poland
boczniak767690 wrote:

Check-out the Trimmomatic and ILLUMINACLIP function. It has a library for different TruSeq adapters which you specify in command.

ADD COMMENTlink modified 13 months ago • written 13 months ago by boczniak767690
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1252 users visited in the last hour