Cutadapt Or Fastx Clipper
1
1
Entering edit mode
10.3 years ago

Hi,

Which one is the best adapter remover for small reads (36 bp and 72 bp long) ? Is there a study to compare adapter remover algorithms ?

cutadapt : http://code.google.com/p/cutadapt/ fastx clipper : http://hannonlab.cshl.edu/fastx_toolkit/index.html

Thanks,

N.

adaptor trimming • 8.3k views
ADD COMMENT
1
Entering edit mode
ADD REPLY
1
Entering edit mode
ADD REPLY
0
Entering edit mode

@maasha: Thanks, I haven't stumbled on biopieces before ... looks interesting!

ADD REPLY
6
Entering edit mode
10.3 years ago

cutadapt has more parameters

fastx is not pair-safe - it will discard sequences that are "all-adapter" which screws up the pairing

the fastx clipper is much more aggressive than cutadapt or scythe using default parameters, for example:

$ cat sample.fq 
@HWI-ST431_52:1:1:1259:1981/1
GTTCAGAGTTCTACAGTCCGACAATCGTATGCCGTNTTCTGCTTGAAAAAANNNANAANNNNANNTNNNNNGNGNNNNNNNNNNNNNNNNNNNNNNNNNNN
+
b`ZUYZKYUSV[[_[cad\\W\[X`ddadc^``^ZB][]\Tc\^`ccbdbBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB

fastx:

$ fastx_clipper -a ATCTCGTATGCCGTCTTCTGCTTG -i sample.fq 
@HWI-ST431_52:1:1:1259:1981/1
GTTCAGAGTTCTACAGTCCGA
+
b`ZUYZKYUSV[[_[cad\\W

cutadapt:

$ cutadapt -a ATCTCGTATGCCGTCTTCTGCTTG sample.fq 
@HWI-ST431_52:1:1:1259:1981/1
GTTCAGAGTTCTACAGTCCGACAATCGTATGCCGTNTTCTGCTTGAAAAAANNNANAANNNNANNTNNNNNGNGNNNNNNNNNNNNNNNNNNNNNNNNNNN
+
b`ZUYZKYUSV[[_[cad\\W\[X`ddadc^``^ZB][]\Tc\^`ccbdbBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB

scythe:

$ scythe -a adapter.fa sample.fq 
@HWI-ST431_52:1:1:1259:1981/1
GTTCAGAGTTCTACAGTCCGACAATCGTATGCCGTNTTCTGCTTGAAAAAANNNANAANNNNANNTNNNNNGNGNNNNNNNNNNNNNNNNNNNNNNNNNNN
+HWI-ST431_52:1:1:1259:1981/1
b`ZUYZKYUSV[[_[cad\\W\[X`ddadc^``^ZB][]\Tc\^`ccbdbBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB

trimmomatic

$trimmomatic SE sample.fq sample.out ILLUMINACLIP:adapter.fa:2:30:10
TrimmomaticSE: Started with arguments:
 sample.fq sample.out ILLUMINACLIP:adapter.fa:2:30:10
Automatically using 2 threads
Using Long Clipping Sequence: 'ATCTCGTATGCCGTCTTCTGCTTG'
ILLUMINACLIP: Using 0 prefix pairs, 1 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Quality encoding detected as phred64
Input Reads: 1 Surviving: 1 (100.00%) Dropped: 0 (0.00%)
TrimmomaticSE: Completed successfully
$ more sample.out
@HWI-ST431_52:1:1:1259:1981/1
GTTCAGAGTTCTACAGTCCGA
+
b`ZUYZKYUSV[[_[cad\\W

fastp

$ fastp -i sample.fq -n 50 -a ATCTCGTATGCCGTCTTCTGCTTG --stdout
Streaming uncompressed output to STDOUT...

@HWI-ST431_52:1:1:1259:1981/1 GTTCAGAGTTCTACAGTCCGACAATCGTATGCCGTNTTCTGCTTGAAAAAANNNANAANNNNANNTNNNNNGNGNNNNNNNNNNNNNNNNNNNNNNNNNNN + bZUYZKYUSV[[_[cad\\W\[Xddadc^`^ZB][]\Tc\^ccbdbBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB

ADD COMMENT
0
Entering edit mode

added recent entries trimmomatic (2014) and fastp (2018)

ADD REPLY

Login before adding your answer.

Traffic: 2286 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6