Question: Cutadapt Or Fastx Clipper
1
gravatar for Nicolas Rosewick
7.9 years ago by
Belgium, Brussels
Nicolas Rosewick8.0k wrote:

Hi,

Which one is the best adapter remover for small reads (36 bp and 72 bp long) ? Is there a study to compare adapter remover algorithms ?

cutadapt : http://code.google.com/p/cutadapt/ fastx clipper : http://hannonlab.cshl.edu/fastx_toolkit/index.html

Thanks,

N.

trimming adaptor • 6.7k views
ADD COMMENTlink modified 7.4 years ago by Jeremy Leipzig18k • written 7.9 years ago by Nicolas Rosewick8.0k
1

Also consider find_adaptor: http://code.google.com/p/biopieces/wiki/find_adaptor

ADD REPLYlink written 7.9 years ago by Martin A Hansen3.0k
1

and consider: https://github.com/ucdavis-bioinformatics/scythe

ADD REPLYlink written 7.9 years ago by brentp23k

@maasha: Thanks, I haven't stumbled on biopieces before ... looks interesting!

ADD REPLYlink written 7.9 years ago by Steve Lianoglou5.0k
6
gravatar for Jeremy Leipzig
7.9 years ago by
Philadelphia, PA
Jeremy Leipzig18k wrote:

cutadapt has more parameters

fastx is not pair-safe - it will discard sequences that are "all-adapter" which screws up the pairing

the fastx clipper is much more aggressive than cutadapt or scythe using default parameters, for example:

$ cat sample.fq 
@HWI-ST431_52:1:1:1259:1981/1
GTTCAGAGTTCTACAGTCCGACAATCGTATGCCGTNTTCTGCTTGAAAAAANNNANAANNNNANNTNNNNNGNGNNNNNNNNNNNNNNNNNNNNNNNNNNN
+
b`ZUYZKYUSV[[_[cad\\W\[X`ddadc^``^ZB][]\Tc\^`ccbdbBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB

fastx:

$ fastx_clipper -a ATCTCGTATGCCGTCTTCTGCTTG -i sample.fq 
@HWI-ST431_52:1:1:1259:1981/1
GTTCAGAGTTCTACAGTCCGA
+
b`ZUYZKYUSV[[_[cad\\W

cutadapt:

$ cutadapt -a ATCTCGTATGCCGTCTTCTGCTTG sample.fq 
@HWI-ST431_52:1:1:1259:1981/1
GTTCAGAGTTCTACAGTCCGACAATCGTATGCCGTNTTCTGCTTGAAAAAANNNANAANNNNANNTNNNNNGNGNNNNNNNNNNNNNNNNNNNNNNNNNNN
+
b`ZUYZKYUSV[[_[cad\\W\[X`ddadc^``^ZB][]\Tc\^`ccbdbBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB

scythe:

$ scythe -a adapter.fa sample.fq 
@HWI-ST431_52:1:1:1259:1981/1
GTTCAGAGTTCTACAGTCCGACAATCGTATGCCGTNTTCTGCTTGAAAAAANNNANAANNNNANNTNNNNNGNGNNNNNNNNNNNNNNNNNNNNNNNNNNN
+HWI-ST431_52:1:1:1259:1981/1
b`ZUYZKYUSV[[_[cad\\W\[X`ddadc^``^ZB][]\Tc\^`ccbdbBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB

trimmomatic

$trimmomatic SE sample.fq sample.out ILLUMINACLIP:adapter.fa:2:30:10
TrimmomaticSE: Started with arguments:
 sample.fq sample.out ILLUMINACLIP:adapter.fa:2:30:10
Automatically using 2 threads
Using Long Clipping Sequence: 'ATCTCGTATGCCGTCTTCTGCTTG'
ILLUMINACLIP: Using 0 prefix pairs, 1 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Quality encoding detected as phred64
Input Reads: 1 Surviving: 1 (100.00%) Dropped: 0 (0.00%)
TrimmomaticSE: Completed successfully
$ more sample.out
@HWI-ST431_52:1:1:1259:1981/1
GTTCAGAGTTCTACAGTCCGA
+
b`ZUYZKYUSV[[_[cad\\W

fastp

$ fastp -i sample.fq -n 50 -a ATCTCGTATGCCGTCTTCTGCTTG --stdout
Streaming uncompressed output to STDOUT...

@HWI-ST431_52:1:1:1259:1981/1 GTTCAGAGTTCTACAGTCCGACAATCGTATGCCGTNTTCTGCTTGAAAAAANNNANAANNNNANNTNNNNNGNGNNNNNNNNNNNNNNNNNNNNNNNNNNN + bZUYZKYUSV[[_[cad\\W\[Xddadc^`^ZB][]\Tc\^ccbdbBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB

ADD COMMENTlink modified 8 months ago • written 7.9 years ago by Jeremy Leipzig18k

added recent entries trimmomatic (2014) and fastp (2018)

ADD REPLYlink written 8 months ago by Jeremy Leipzig18k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2485 users visited in the last hour