Merge Paired-End Reads
7
9
Entering edit mode
10.6 years ago

Hi,

How can I merge two paired end fastq (R and L) to give a single fastq file ? For information, the sequencing run is 72 bp long and it contains a majority of small RNA (miRNA,...) so a lot of paired end reads will overlap.

For example here's two paired reads :

@HWUSI-EAS529:41:FC62YHFAAXX:8:1:7969:1330 1:N:0:GCCAAT
CTACGAAAGGGCACTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCT
+
IIIIIIIHIIHIIIIIIHHIIIHGIIIIEIIIIIIEIIHIIIIIIIIIIIHIIIIIBHIHIIHGIGIEGHHEGEEH


@HWUSI-EAS529:41:FC62YHFAAXX:8:1:7969:1330 2:N:0:GCCAAT
AGTGCCCTTTCGTAGGATCGTCGGACTGTAGAACTCTGAACGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAA
+
IIIIIIIIIIIIIIIIIIIIIIIDHIGIIIHIIIGHGIIIIIIIHHIHIIIIIIIIIHIIIIIIIIHIIGIIIIHI

I find the adapter in the first one :

Code:

EMBOSS_001         1 CTACGAAAGGGCACTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGC     50
                                    |||||||||||||||||||||              
EMBOSS_001         1 ---------------TGGAATTCTCGGGTGCCAAGG--------------     21

EMBOSS_001        51 CAATATCTCGTATGCCGTCTTCTGCT     76

EMBOSS_001        22 --------------------------     21

but not in the second one ...

But I effectively found the overlap between the right read and the left read (using the reverse complement of it)

EMBOSS_001         1 --------------------------------------------------      0

EMBOSS_001         1 TTTTTTAATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACA     50

EMBOSS_001         1 -----------CTACGAAAGGGCACTTGGAATTCTCGGGTGCCAAGGAAC     39
                                |||||||||||||||                        
EMBOSS_001        51 GTCCGACGATCCTACGAAAGGGCACT------------------------     76

EMBOSS_001        40 TCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCT     76

EMBOSS_001        77 -------------------------------------     76

So my question is, how can I merge the two fastq files to produce a single fastq file ?

Thanks,

N.

merge paired rna fastq • 26k views
ADD COMMENT
1
Entering edit mode

Hi, I see that you had a similar case like me, so probably you can help me :) 

As I always do the miRNA analysis in single end I'm confused how to proceed when I have paired-end? Can you recommend me how to clean the reads and have them ready for analysis, particularly I cannot understand how and what is the relation of the reverse-compliment miRNA sequence in R2 read to the R1 set?
In summary my R1 read is containing 100nt - miRNA+barcode+smallRNAadapter+another adapter+polyA
my R2 is containing miRNA (reversed compliment to R1) + long adapter (or linker) + polyA

Thanks for any help in advance!

ADD REPLY
0
Entering edit mode

Hi,

So for an exact answer to this problem.

the R1.fq are the foward reads and the R2.fq are written in reverse-complement.

For example, if I want to create a single file from reads in R1.fq and R2.fq, I have to do "reverse-complement" of reads in R2.fq??

am I right?

Thank you

ADD REPLY
0
Entering edit mode

no response for this problem?

ADD REPLY
2
Entering edit mode
10.6 years ago
pmenzel ▴ 310

Maybe this program is suited for you: http://www.cbcb.umd.edu/software/flash/

ADD COMMENT
0
Entering edit mode

It's no available, the web page cannot be open. http://genomics.jhu.edu/software/FLASH/index.shtml

ADD REPLY
0
Entering edit mode
ADD REPLY
1
Entering edit mode
10.6 years ago

There is a decent program called stitch:[?] https://github.com/audy/stitch

I wrote a script called mergePairs that is very sensitive and incredibly slow:[?] http://code.google.com/p/standardized-velvet-assembly-report/source/browse/trunk/mergePairs.py

ADD COMMENT
1
Entering edit mode
8.9 years ago
lelle ▴ 830

As this was referenced from a duplicate question, I will add a newer tool to the list: PANDAseq

ADD COMMENT
1
Entering edit mode
7.2 years ago
Andreas ★ 2.5k

One more: SeqPrep

Andreas

ADD COMMENT
0
Entering edit mode
10.6 years ago
Stevelor ▴ 310

Either use Galaxy or use the single scripts

http://hg.notalon.org/galaxy/galaxy-central/src/7d9bb95caaa7/tools/fastq

HTH!

ADD COMMENT
1
Entering edit mode

uhhh which script?

ADD REPLY
0
Entering edit mode
7.2 years ago
Gabriel R. ★ 2.8k

If you wish to trim adapters and merge in a single step, you can the leeHom, we use it mainly to reconstruct ancient DNA sequences but it has broader uses as well:

http://nar.oxfordjournals.org/content/42/18/e141

Click here for the Website of the repository

It use a Bayesian maximum a posteriori approach that considers quality scores for both the adapter determination and the merging part.

ADD COMMENT
0
Entering edit mode
4.8 years ago
FatihSarigol ▴ 240

There is BBMerge, which is ""designed to merge two overlapping paired reads into a single read. For example, a 2x150bp read pair with an insert size of 270bp would result in a single 270bp read"": http://jgi.doe.gov/data-and-tools/bbtools/bb-tools-user-guide/bbmerge-guide/

ADD COMMENT

Login before adding your answer.

Traffic: 852 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6