transcription factor binding site prediction software/server
4
2
Entering edit mode
7.9 years ago

Hi,

I have a DNA sequence (fasta file format), I would like to predict transcription factor binding site (TFBS) and ribosomal binding sites (RBS).

Is there an easy software/server which predicts TFBS and RBS.

I tried to use R package for TFBS prediction using biocLite("JASPAR2014"), but I don't understand it.

Best!

Shashank

sequence genome-sequencing • 7.0k views
ADD COMMENT
0
Entering edit mode

This is the prokaryotic sequence, and I need to find the TFBS and RBS, above-mentioned software doesn't work.

AACTCTGAGATATTGACTTGAAGCATTTCATAAAGTTCAATGTTCAAATCTCAAAGTTCAAAGTTATTTATTCGTCTCTCATTGCATCTACCGGCTTGATGCTCATGGCTCGCCAGGCTGGGGCAAGTCCGGCTAGGCCGCCAAGGATGCAGATGAGGATGGCTGAAGAGATGGCCGTCCAGAAATCTACCTGGAAATGGGCGGTGAGAATGCCATCCGTGGTGTTCGCCATCTCCAGCATCTGCAGGATGGCTACTCCGAAGATGATGCCGCTCATGCCTGCCACCAGGGTGAGGAGAATACTCTCTGAGATGATTTGCGAGAGAATCATCTTCGGCGTGGCGCCGATGGCTCGGCGAATGCCTATCTCGGTGGTTCGCTCCTTCACCGTTACCATCATGATGTTGGAAACTCCGATGGCGCCGGCGAGAAGGGTGCCGATACCTACCAGCCAGATGAGGAAGTTGACGCCCTTAAACAGATTGTCGAGCATCTGGAAGAGCACCTCCGTATTGAACACCATGATTCCCTTTTCATCTGAAGGGTCGATGTTATGGGCCCTGGCTATGGTTTCACGCATTCGCTGGGCGATGTTGCTCATCACTACGCCCGGCTTACCGGTGGTGGCGATGATGTCGATGGCGGTTCCGCGGTTGTAG
ADD REPLY
0
Entering edit mode

If the free help you're given doesn't meet your needs, please do a better job of communicating why and how those options do not work.

ADD REPLY
0
Entering edit mode

Prediction Aviator

ADD REPLY
1
Entering edit mode
7.9 years ago
dago ★ 2.7k

It depends which organism are you working with.

Following these links you can find useful tools:

You can also look at Virtual Footprint, "It was especially designed to analyze transcription factor binding sites in whole bacterial genomes and their underlying regulatory networks."

ADD COMMENT
0
Entering edit mode

I have a prokaryotic sequence. Does the above mentioned link work for it?

ADD REPLY
0
Entering edit mode

You should report a bit more in detail what you want to do. I think Virtual Footprint can help you, see my edit.

ADD REPLY
1
Entering edit mode
7.9 years ago
TriS ★ 4.6k

mapper worked fine for me.

ADD COMMENT
0
Entering edit mode

I have a prokaryotic sequence, so I don't think MAPPER is gonna work.

ADD REPLY
1
Entering edit mode
7.2 years ago
rutial ▴ 40

You can use Genome Compiler - they have embedded into their software the RBS Calculator by Prof. Howard Salis.

Here are some helpful articles and tutorial video: How to use, Q&A with Salis, Tutorial video.

ADD COMMENT
1
Entering edit mode
7.2 years ago
oigl ▴ 60

You can use weight matrices or SITECON to predict TFBS in UGENE.

ADD COMMENT

Login before adding your answer.

Traffic: 2413 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6