Question: GATK VariantRecalibrator error: Values for DP annotation not detected for ANY training variant
1
gravatar for nbhardwaj
3.8 years ago by
nbhardwaj110
United States
nbhardwaj110 wrote:

Hi,

I have another question related with GATK, specifically VariantRecalibrator in the INDEL mode:

 

$java -jar GenomeAnalysisTK.jar -T VariantRecalibrator -R Ref.fasta -input recal_snps.vcf -mode INDEL -recalFile indel.recal -tranchesFile indel.tranches -rscriptFile indel.recal.plots.R -resource:dbSNP,known=true,training=true,truth=true,prior=6.0 20M_filtered.vcf  -an DP -an MQ

INFO  21:59:32,158 HelpFormatter - --------------------------------------------------------------------------------
INFO  21:59:32,164 HelpFormatter - Program Args: -T VariantRecalibrator -R /home/bioinfo/data/genomes/rice/nipponbare_v7.0/index/bwa/Os_nipponbare_v7.0_genome.fasta -input all_chr_recal_snps.vcf -mode INDEL -recalFile all_chr.raw.indel.recal -tranchesFile all_chr.raw.indel.tranches -rscriptFile all_chr.indel.recal.plots.R -resource:dbSNP,known=true,training=true,truth=true,prior=6.0 /home/bioinfo/data/genomes/rice/nipponbare_v7.0/variations/20M_filtered/20M_filtered.vcf -an DP -an MQ
INFO  21:59:32,226 HelpFormatter - Executing as bioinfo@toro on Linux 2.6.32-358.23.2.el6.x86_64 amd64; OpenJDK 64-Bit Server VM 1.7.0_51-mockbuild_2014_01_15_01_39-b00.
INFO  21:59:32,357 GenomeAnalysisEngine - Downsampling Settings: Method: BY_SAMPLE, Target Coverage: 1000
INFO  21:59:32,502 GenomeAnalysisEngine - Preparing for traversal
INFO  21:59:32,505 GenomeAnalysisEngine - Done preparing for traversal
INFO  21:59:32,505 ProgressMeter - [INITIALIZATION COMPLETE; STARTING PROCESSING]
INFO  21:59:32,505 ProgressMeter -                 | processed |    time |    per 1M |           |   total | remaining
INFO  21:59:32,506 ProgressMeter -        Location |     sites | elapsed |     sites | completed | runtime |   runtime
INFO  21:59:32,509 TrainingSet - Found dbSNP track:     Known = true    Training = true         Truth = true    Prior = Q6.0
INFO  22:00:02,510 ProgressMeter -   Chr1:12909320    221975.0    30.0 s       2.3 m        3.4%    14.5 m      14.0 m
.....
.....
INFO  22:11:32,574 ProgressMeter -  Chr12:10944016   6647515.0    12.0 m     108.0 s       95.2%    12.6 m      35.0 s
INFO  22:12:02,577 ProgressMeter -  Chr12:26375047   6960773.0    12.5 m     107.0 s       99.4%    12.6 m       4.0 s
INFO  22:12:04,448 VariantDataManager - DP:      mean = NaN      standard deviation = NaN
INFO  22:12:16,628 GATKRunReport - Uploaded run statistics report to AWS S3
##### ERROR ------------------------------------------------------------------------------------------
##### ERROR MESSAGE: Bad input: Values for DP annotation not detected for ANY training variant in the input callset. VariantAnnotator may be used to add these annotations. See http://gatkforums.broadinstitute.org/discussion/49/using-variant-annotator

 

Although I do have DP and MQ annotations for the indels in my input vcf (recal_snps.vcf). Here are some examples:

Chr1    11093   .       G       GACTCCCTCAGTGGTTTTGGAGGGTGGTTTCGCT      7666.65 .       AC=2;AF=1.00;AN=2;DP=129;FS=0.000;MLEAC=2;MLEAF=1.00;MQ=30.51;MQ0=0;QD=28.15        GT:AD:DP:GQ:PL  1/1:0,129:129:99:7696,526,0
Chr1    11100   .       T       TGTTGATCTGG     5820.65 .       AC=2;AF=1.00;AN=2;DP=121;FS=0.000;MLEAC=2;MLEAF=1.00;MQ=29.00;MQ0=0;QD=30.27    GT:AD:DP:GQ:PL      1/1:0,121:121:99:5850,391,0
Chr1    11194   .       T       TTTCTCC 4843.65 .       AC=2;AF=1.00;AN=2;DP=101;FS=0.000;MLEAC=2;MLEAF=1.00;MQ=37.97;MQ0=0;QD=29.72    GT:AD:DP:GQ:PL      1/1:0,100:100:99:4873,340,0

Also, it runs fine in the SNP mode with the exact same annotations. So, I dont know if it will help to run VariantAnnotator.

 Here is how my dbSNP file looks like:

Chr1    1465    10100001465     A       G       .       PASS    .       GT      ./.     1/1     ./.     ./.
Chr1    1482    10100001482     C       T       .       PASS    .       GT      1/1     0/0     ./.     ./.     1/1
Chr1    1573    10100001573     T       C       .       PASS    .       GT      ./.     ./.     ./.     ./.     1/1

Please let me know what can I do to fix this.

Thanks and best regards,

Neil

variantrecalibrator gatk • 2.7k views
ADD COMMENTlink modified 3.8 years ago by RamRS19k • written 3.8 years ago by nbhardwaj110
1

How did you solve this error ? Did you run VariantAnnotator on this one ?

ADD REPLYlink written 2.7 years ago by always_learning930

Did you run VariantAnnotator on your vcf files?

ADD REPLYlink written 3.8 years ago by Renesh1.4k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1806 users visited in the last hour