Question: I am having trouble putting multiple maf alignments into one file so the parser can identify it as two alignments
1
gravatar for Avro
4.8 years ago by
Avro140
Canada
Avro140 wrote:

Hi everyone!

I have a large file of maf alignments for multiple non-coding RNA. I want to use the RNAz server (http://rna.tbi.univie.ac.at/cgi-bin/RNAz.cgi) with the standard analysis. Here is an example of two maf alignments:

Alignment 1

##maf version=1

# maf_parse -s 1000 -e 1100 chromosome_1_nine_species.maf

a score=3095.0

s AT.scaffold1      999 72 + 30427671 TGGTTATAAATTATTAGAAGTTTTCCACTTATGACTTAAGAACTTGTGAAGCAGAAAGTGGCAACANNNNNN

s CR.scaffold1 19180319 67 - 19624517 TGTTGAAAATCAATAAAAAGTTTTCCACATATGACTT-----TGTGAGAGGGAGAAGGAGGCAACAAACCCC

 

a score=1449.0

s AT.scaffold1     1097 3 + 30427671 AAA

s CR.scaffold1 19180393 3 - 19624517 AAA

 

#eof

Alignment 2

##maf version=1

# maf_parse -s 1200 -e 1300 chromosome_1_nine_species.maf

a score=1449.0

s AT.scaffold1     1199 101 + 30427671 AAAAAGTTGTAATTATTAATGATAGTTCTGTGATTCCTCCATGAATCACATCTGCTTGATTTTTCTTTCATAAATTTATAAGTAATACATTCTTATAAAAT

s CR.scaffold1 19180510  26 - 19624517 AGAAAGGTGTAAAT-------------TTGTAATTC--------------------------------------------------------------AAT

 

#eof

I am trying to put them into a file so, I can send the file to the server that will parse the maf alignments. My problem is that the server recognizes everything as 1 maf. Could someone please tell how to add multiple mafs together so a parser can read them? Thank you!

 

maf • 1.1k views
ADD COMMENTlink written 4.8 years ago by Avro140
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 852 users visited in the last hour