Circularizing and trimming with toAmos and minimus2
0
1
Entering edit mode
9.3 years ago
k.mamoud ▴ 10

Dear all,

I am trying to follow the Circularizing and trimming described here for pacbio assembly.

I have tried many times but I could not get the result circularized.fasta from the overlapping step and joining step from minimus2. I tried a test.fasta by putting a break in the middle after making a reverse of my contig:

>contig
ACGTCTACTACTACGTAGCTACTACTGTGAATCTAGGACTACTAGCTAGCTATCGTACTATCGATCTCTACTGCG
>break
GCGTCATCTCTAGCTATCATGCTATCGATCGATCATCAGGATCTAAGTGTCATCATCGATGCATCATCATCTGCA
amos-3.1.0/bin/toAmos -s rev.fasta -o circularized.afg
amos-3.1.0/bin/minimus2 circularized

I get all these files

circularized.bnk circularized.fasta circularized.qry.seq
circularized.singletons.seq circularized.contig
circularizedls.runAmos.log circularized.ref.seq
BioPerl-1.6.1 circularized.coords circularized.ovl
circularized.runAmos.log
circularized.afg circularized.delta circularized.OVL
circularized.singletons

When I am checking the circularized.fasta,it is empty and I do not have any error in my log, all the contigs are here

circularized.singletons.seq
cat circularized.singletons.seq
>contig
ACGTCTACTACTACGTAGCTACTACTGTGAATCTAGGACTACTAGCTAGCTATCGTACTATCGATCTCTA
CTGCG
>break
GCGTCATCTCTAGCTATCATGCTATCGATCGATCATCAGGATCTAAGTGTCATCATCGATGCATCATCAT
CTGCA
pacbio-assembly trimming minimus2 circulizing amos • 3.3k views
ADD COMMENT
0
Entering edit mode

Rest of the message

cat circularized.runAmos.log


!!! 2015-03-17 17:56:38 Started by root@... on Tue Mar
17 17:56:38 2015

!!! 2015-03-17 17:56:38 Doing step 10: Building AMOS bank & Dumping reads
!!! 2015-03-17 17:56:38 Running: rm -fr circularized.bnk
!!! 2015-03-17 17:56:38 Done! Elapsed time:0d 0h 0m 0s

!!! 2015-03-17 17:56:38 Doing step 11
!!! 2015-03-17 17:56:38 Running: /root/amos-3.1.0/bin/bank-transact -c -z
-b circularized.bnk -m circularized.afg
START DATE: Tue Mar 17 17:56:38 2015
Bank is: circularized.bnk
0% 100%
AFG ..................................................
Messages read: 6
Objects added: 6
Objects deleted: 0
Objects replaced: 0
END DATE: Tue Mar 17 17:56:38 2015
!!! 2015-03-17 17:56:38 Done! Elapsed time:0d 0h 0m 0s

!!! 2015-03-17 17:56:38 Doing step 12
!!! 2015-03-17 17:56:38 Running: /root/amos-3.1.0/bin/dumpreads
circularized.bnk -M 0 > circularized.ref.seq
Objects seen: 2
Objects written: 2
!!! 2015-03-17 17:56:38 Done! Elapsed time:0d 0h 0m 0s

!!! 2015-03-17 17:56:38 Doing step 13
!!! 2015-03-17 17:56:38 Running: /root/amos-3.1.0/bin/dumpreads
circularized.bnk -m 0 > circularized.qry.seq
Objects seen: 2
Objects written: 2
!!! 2015-03-17 17:56:38 Done! Elapsed time:0d 0h 0m 0s

!!! 2015-03-17 17:56:38 Doing step 20: Getting overlaps
!!! 2015-03-17 17:56:38 Running: /root/MUMmer3.23/nucmer -maxmatch -c 40
circularized.ref.seq circularized.qry.seq -p circularized
1: PREPARING DATA
2,3: RUNNING mummer AND CREATING CLUSTERS
# reading input file "circularized.ntref" of length 152
# construct suffix tree for sequence of length 152
# (maximum reference length is 536870908)
# (maximum query length is 4294967295)
# CONSTRUCTIONTIME /root/MUMmer3.23/mummer circularized.ntref 0.00
# reading input file "/root/circularized.qry.seq" of length 151
# matching query-file "/root/circularized.qry.seq"
# against subject-file "circularized.ntref"
# COMPLETETIME /root/MUMmer3.23/mummer circularized.ntref 0.00
# SPACE /root/MUMmer3.23/mummer circularized.ntref 0.00
4: FINISHING DATA
!!! 2015-03-17 17:56:39 Done! Elapsed time:0d 0h 0m 1s

!!! 2015-03-17 17:56:39 Doing step 21
!!! 2015-03-17 17:56:39 Running: /root/MUMmer3.23/show-coords -H -c -l -o
-r -I 94 circularized.delta | /root/amos-3.1.0/bin/nucmerAnnotate | egrep
'BEGIN|END|CONTAIN|IDENTITY' > circularized.coords
!!! 2015-03-17 17:56:39 Done! Elapsed time:0d 0h 0m 0s

!!! 2015-03-17 17:56:39 Doing step 22
!!! 2015-03-17 17:56:39 Running: /root/amos-3.1.0/bin/nucmer2ovl -ignore
20 -tab circularized.coords | /root/amos-3.1.0/bin/sort2 > circularized.ovl
!!! 2015-03-17 17:56:39 Done! Elapsed time:0d 0h 0m 0s

!!! 2015-03-17 17:56:39 Doing step 23: Converting overlaps
!!! 2015-03-17 17:56:39 Running: /root/amos-3.1.0/bin/ovl2OVL
circularized.ovl > circularized.OVL
!!! 2015-03-17 17:56:39 Done! Elapsed time:0d 0h 0m 0s

!!! 2015-03-17 17:56:39 Doing step 24: Loading overlaps to the bank
!!! 2015-03-17 17:56:39 Running: rm -f circularized.bnk/OVL.*
!!! 2015-03-17 17:56:39 Done! Elapsed time:0d 0h 0m 0s

!!! 2015-03-17 17:56:39 Doing step 25
!!! 2015-03-17 17:56:39 Running: /root/amos-3.1.0/bin/bank-transact -z -b
circularized.bnk -m circularized.OVL
START DATE: Tue Mar 17 17:56:39 2015
Bank is: circularized.bnk
0% 100%
AFG
Messages read: 0
Objects added: 0
Objects deleted: 0
Objects replaced: 0
END DATE: Tue Mar 17 17:56:39 2015
!!! 2015-03-17 17:56:39 Done! Elapsed time:0d 0h 0m 0s

!!! 2015-03-17 17:56:39 Doing step 30: Running contigger
!!! 2015-03-17 17:56:39 Running: rm -f circularized.bnk/LAY.*
!!! 2015-03-17 17:56:39 Done! Elapsed time:0d 0h 0m 0s

!!! 2015-03-17 17:56:39 Doing step 31
!!! 2015-03-17 17:56:39 Running: /root/amos-3.1.0/bin/tigger -b
circularized.bnk
Pulling reads from bank circularized.bnk
Pulled 2 reads from bank
AMOS Overlap Bank circularized.bnk does not exist
total contained reads hidden 0
number of contigs 2
total contained reads unhidden 0
Writing layouts to bank circularized.bnk
!!! 2015-03-17 17:56:39 Done! Elapsed time:0d 0h 0m 0s

!!! 2015-03-17 17:56:39 Doing step 40: Running consensus
!!! 2015-03-17 17:56:39 Running: rm -f circularized.bnk/CTG.*
!!! 2015-03-17 17:56:39 Done! Elapsed time:0d 0h 0m 0s

!!! 2015-03-17 17:56:39 Doing step 41
!!! 2015-03-17 17:56:39 Running: /root/amos-3.1.0/bin/make-consensus -B -e
0.06 -b circularized.bnk -w 15
Starting on Tue Mar 17 17:56:39 2015

Read bank is circularized.bnk
Alignment error rate is 0.06
Minimum overlap bases is 5
Output will be written to the bank
Input is being read from the bank
Processed 0 layouts
!!! 2015-03-17 17:56:39 Done! Elapsed time:0d 0h 0m 0s

!!! 2015-03-17 17:56:39 Doing step 50: Outputting contigs
!!! 2015-03-17 17:56:39 Running: /root/amos-3.1.0/bin/bank2contig
circularized.bnk > circularized.contig
Processing circularized.bnk at Tue Mar 17 17:56:39 2015
End: Tue Mar 17 17:56:39 2015
!!! 2015-03-17 17:56:39 Done! Elapsed time:0d 0h 0m 0s

!!! 2015-03-17 17:56:39 Doing step 60: Converting to FastA file
!!! 2015-03-17 17:56:39 Running: /root/amos-3.1.0/bin/bank2fasta -b
circularized.bnk > circularized.fasta
!!! 2015-03-17 17:56:39 Done! Elapsed time:0d 0h 0m 0s

!!! 2015-03-17 17:56:39 Doing step 70: Getting singletons
!!! 2015-03-17 17:56:39 Running: /root/amos-3.1.0/bin/listReadPlacedStatus
-S -E circularized.bnk > circularized.singletons
!!! 2015-03-17 17:56:39 Done! Elapsed time:0d 0h 0m 0s

!!! 2015-03-17 17:56:39 Doing step 71
!!! 2015-03-17 17:56:39 Running: /root/amos-3.1.0/bin/dumpreads -e -E
circularized.singletons circularized.bnk > circularized.singletons.seq
Objects seen: 2
Objects written: 2
!!! 2015-03-17 17:56:39 Done! Elapsed time:0d 0h 0m 0s

!!! END - Elapsed time: 0d 0h 0m 1s

Any idea?

Thanks in advance

ADD REPLY
0
Entering edit mode

I also have same problem . Did you manage it ??

ADD REPLY
0
Entering edit mode

Hello,

No I could not, but I saw that at the step 21 my *.ovl file is empty, have you the same problem?

Best

ADD REPLY
0
Entering edit mode

I checked at step 21 my *.ovl file is empty,if someone gets the same problem?

ADD REPLY
0
Entering edit mode

Hello, I also have the same problem with the *.ovl file empty, does any one find a solution

Regards

ADD REPLY

Login before adding your answer.

Traffic: 3085 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6