Question: Isaac Aligner with Solexa data fails
1
gravatar for win
4.1 years ago by
win810
India
win810 wrote:

Hi all,

I am trying to align a fastq file from the solexa platform using the Isaac Aligner and I get the following error after a few minutes of processing.

[7f5e2c47d780]  FastqFlowcellInfo(2,119:0,[1 ])
2015-03-20 16:48:35     [7f5e2c47d780]  use bases mask: yyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyn
2015-03-20 16:48:35     [7f5e2c47d780]  reads parsed: 1
2015-03-20 16:48:35     [7f5e2c47d780]  Discovered data read: ReadMetadata(1, 118 [1, 118], 0id, 0off,1frc)
2015-03-20 16:48:35     [7f5e2c47d780]  constructed extremity seed SeedMetadata(0, 32, 0, 0)
2015-03-20 16:48:35     [7f5e2c47d780]  constructed extremity seed SeedMetadata(86, 32, 0, 1)
2015-03-20 16:48:35     [7f5e2c47d780]  constructed SeedMetadata(32, 32, 0, 2)
2015-03-20 16:48:35     [7f5e2c47d780]  constructed overlapping SeedMetadata(16, 32, 0, 3)
2015-03-20 16:48:35     [7f5e2c47d780]  Generated 'none' barcode: BarcodeMetadata(2,1,default,none,(o), 4294967295)
2015-03-20 16:48:35     [7f5e2c47d780]  align: Setting memory limit to 42949672960 bytes.
2015-03-20 16:48:35     [7f5e2c47d780]  Aligner: adding base-calls path "/datadrive/isaacDenisovan"
2015-03-20 16:48:35     [7f5e2c47d780]  Determining memory capacity for Fastq data
2015-03-20 16:48:35     [7f5e2c47d780]  Determining memory capacity for Fastq data done. 223980279 clusters of length 118 will fit
2015-03-20 16:49:45     [7f5e2c47d780]  Opened fastq stream on /datadrive/isaacDenisovan/lane1_read1.fastq
Error: 2015-Mar-20 16:49:47: Invalid argument: /home/peterz/isaacAlnSrc/isaac_aligner-master/src/c++/include/io/FastqReader.hh(194): Throw in function InsertIt isaac::io::FastqReader::extractBcl(const isaac::flowcell::ReadMetadata&, InsertIt) const [with InsertIt = __gnu_cxx::__normal_iterator<char*, std::vector<char> >]
Dynamic exception type: boost::exception_detail::clone_impl<isaac::common::IoException>
std::exception::what: Read length (99)  is different from expected 118 in /datadrive/isaacDenisovan/lane1_read1.fastq:294. Record @M_SOLEXA-GA03_PEi_JK_3004_5:5:4:12109:5782#GTCGACT
GTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGAGATCGGAAGAGCA
+
B@I(KFNMQBLO+QPIHNLPTCNQJRUOKPSVU'U\QZ\QYWY][YX]WV]W\]W]]U]\X[\V][Z]]&Y]R][W]ZUV[V[XU&-T&*YO-NI+R&P
: Read length (99)  is different from expected 118 in /datadrive/isaacDenisovan/lane1_read1.fastq:294. Record @M_SOLEXA-GA03_PEi_JK_3004_5:5:4:12109:5782#GTCGACT
GTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGAGATCGGAAGAGCA
+
B@I(KFNMQBLO+QPIHNLPTCNQJRUOKPSVU'U\QZ\QYWY][YX]WV]W\]W]]U]\X[\V][Z]]&Y]R][W]ZUV[V[XU&-T&*YO-NI+R&P

Any ideas what this could mean? Thanks in advance.
alignment • 1.1k views
ADD COMMENTlink modified 4.1 years ago by Ido Tamir5.0k • written 4.1 years ago by win810
1
gravatar for Ido Tamir
4.1 years ago by
Ido Tamir5.0k
Austria
Ido Tamir5.0k wrote:

Unfortunately bioinformatics is also reading error messages very carefully sometimes:

The reads in the fastq file are 99, but you specified 118Y1N. You have to speicify 99Y19N or something similar (99Y?) somewhere.

ADD COMMENTlink written 4.1 years ago by Ido Tamir5.0k

where to make that setting change.

ADD REPLYlink written 4.1 years ago by win810
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1494 users visited in the last hour