Bwa Sam Output Doubts
2
3
Entering edit mode
14.1 years ago
Seq_Ga ▴ 30

Can anyone explain the following tags from BWA sam output.

GA004_0001:5:1:1073:12995#0   0       chr10   135119228       37      75M     *       0       0       CTGGGTTTGGCATAGTGGGAGGGCAGGCAGGGGTGGTTTTCCTGGCTACTCAGGGTTGCAGAGGACAGGACCGA
A     CCCBCCCBCBCCC=CCCCCCCC@@BCCCCCCBC?C>=CCACAC@A+?;<;BAA@A08A++?6?<9ACCC68=C8<     XT:A:U  NM:i:1  X0:i:1  X1:i:0  XM:i:1  XO:i:0  XG:i:0  MD:Z:45A29

How to check whether a tags in unique hot or multiple hits as sam flag is bit confusing to read. Thanks.

sam output bwa alignment format • 7.4k views
ADD COMMENT
0
Entering edit mode

XT:A:U means unique and XT:A:R means repeats. What are the other X:?:? tags used. Please explain.

ADD REPLY
3
Entering edit mode
14.1 years ago

Here and in more details here, you can find a good description of the SAM/BAM standard and what all fields mean. There is also a page with predefined tags and it says how you can make your own.

Those starting with X,Y and Z are "reserved for end user" Maybe an intermediate program?

NM:i:1 Number of nucleotide differences

MD:Z:45A29 String of mismatching position

I don't quite understand when you say "tags in unique hit or multiple hits"

ADD COMMENT
3
Entering edit mode
14.1 years ago
Darked89 4.6k

Multiple vs unique hits are encoded in a numerical form.

For checking just one flag: http://picard.sourceforge.net/explain-flags.html

For checking multiple tags on a command line: http://picard.svn.sourceforge.net/viewvc/picard/trunk/src/scripts/explain_sam_flags.py

Just collect all unique tags from your SAM file and see what you got there first.

See also "SAM format parsing / stats" post

ADD COMMENT

Login before adding your answer.

Traffic: 3247 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6