Question: Convert annovar file to vcf file
0
gravatar for amitgsir
4.1 years ago by
amitgsir50
Incheon, South Korea
amitgsir50 wrote:

Hi,

I have a annovar file for the High Confidence Indels which looks like this:

 

#Chr    Start    Ref    Obs
1    1588536    -    TAA
1    1588745    GCG    -
1    1651078    -    TCGCTCTGTCACCCAGGCT
1    2184046    C    -
1    2615857    CTGGAACACCACCCTGCACCCCCAGGTGAGCATCTGACGGC    -
1    8087069    -    TA
1    8337360    -    CTCA
1    10357207    T    -
1    14109409    TT    -
1    17631815    -    A

 

Since, annovar uses "-" for Insertion or Deletion, I can not use this file directly to compare with vcf files.

Can anyone tell me how I can convert this annovar file to vcf file (with reference to hg19).

Thanks

 

Amit Goyal

next-gen assembly • 2.1k views
ADD COMMENTlink modified 4.1 years ago • written 4.1 years ago by amitgsir50
0
gravatar for amitgsir
4.1 years ago by
amitgsir50
Incheon, South Korea
amitgsir50 wrote:

I got an answer for Kai Wang. I hope it can help others too.

 

"Hi Amit,

You will need to convert this to VCF yourself, by padding the nucleotide that corresponds to "-". This can be done by retrieve_seq_from_fasta.pl (specifying chr:start-end).

 

But you can certainly compare this file to VCF directly. Just use -vcf as dbtype option in -filter operation.

-Kai"

ADD COMMENTlink written 4.1 years ago by amitgsir50
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1617 users visited in the last hour