Convert annovar file to vcf file
1
0
Entering edit mode
7.3 years ago
amitgsir ▴ 60

Hi,

I have a annovar file for the High Confidence Indels which looks like this:

#Chr    Start       Ref                                          Obs
1       1588536     -                                            TAA
1       1588745     GCG                                          -
1       1651078     -                                            TCGCTCTGTCACCCAGGCT
1       2184046     C                                            -
1       2615857     CTGGAACACCACCCTGCACCCCCAGGTGAGCATCTGACGGC    -
1       8087069     -                                            TA
1       8337360     -                                            CTCA
1       10357207    T                                            -
1       14109409    TT                                           -
1       17631815    -                                            A

Since, annovar uses "-" for Insertion or Deletion, I can not use this file directly to compare with vcf files.

Can anyone tell me how I can convert this annovar file to vcf file (with reference to hg19).

Thanks

Amit Goyal

next-gen Assembly • 3.6k views
ADD COMMENT
1
Entering edit mode
7.3 years ago
amitgsir ▴ 60

I got an answer for Kai Wang. I hope it can help others too.

Hi Amit,

You will need to convert this to VCF yourself, by padding the nucleotide that corresponds to "-". This can be done by retrieve_seq_from_fasta.pl (specifying chr:start-end).

But you can certainly compare this file to VCF directly. Just use -vcf as dbtype option in -filter operation.

-Kai

ADD COMMENT
0
Entering edit mode

Hi Amit,

Would you please list the steps on how you went about the retrieving the bases for '-'

Many thanks, Faraz.

ADD REPLY

Login before adding your answer.

Traffic: 1374 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6