Question: Protocol of cutadapt
0
gravatar for gufernandez10
3.1 years ago by
Chile
gufernandez1010 wrote:

Hi, i'm newbie in this forum, i'm using option -b with cutadapt to trim adapter from the fastq files ,  but I lose interest sequence of each reads when the adapter is in the middle or is not in a end of the read. my question is: How Cutadapt defines the cut before or after finding an adapter located in the middle of the read?.  Colored sequence was removed : the command used was

cutadapt -b AGATC -o output.fastq input.fastq 

 

1 → AGATCTGGAGGA
2 → GTGAAATAGATCCTGAAACCGTA
3 →AGCGGAGTGAAATAGATCCTGAAACCGTATGCTCTAGTCTTGTGACGA
4 CGCAGAACAGAGCGTGCATAACGACTGAAAAGCGACGCAGATCAAAGTGGAAGATGTACTGTTTGCGATGGTGAAAGAAGTAGAAAATCGCCCAGCTGTT
5 →
CGAGGCGCTCGCTTCAGATCATACTAGCGTGAAAAGGTAAACACGTGCGATGAGCGGAACGTATCCAAATCTATCTAATCCACCCATCGTAGAT
6 →CACTTGAACTCCGCCATCTCCGTTACTTCATCACAGTGGCTGAAGATCTGCATTTCAGCCGCGCGGCAGAGC

I would appreciate any help.

rna-seq • 1.3k views
ADD COMMENTlink written 3.1 years ago by gufernandez1010

Why you use option b, instead of a or g? Are your adapters in 5' or 3' ends of reads?

ADD REPLYlink written 3.1 years ago by PoGibas4.7k

hi, yes, some adapters and contaminants appearing in different parts of the reads, i identifies some contaminants with fastqc.

ADD REPLYlink written 3.1 years ago by gufernandez1010

To answer your question: "How Cutadapt defines the cut?".

Cutadapt states this very clearly: "The adapter itself and anything that follows is trimmed".

But are your using right tool do achieve wanted results? cutadapt removes adapters and if you want to remove contaminants you might want to use another tool.

ADD REPLYlink modified 3.1 years ago • written 3.1 years ago by PoGibas4.7k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1372 users visited in the last hour