Question: Downloading SRA data using the SRA Toolkit
0
gravatar for Angel
4.4 years ago by
Angel3.5k
Angel3.5k wrote:

Hey,

i opened cmd and typed C:\Users\yang\Downloads\Compressed\sratoolkit.2.5.0-win64\bin

then i typed fastq-dump -X 5 -Z SRR390728

in cmd i am watching

C:\Users\yang\Downloads\Compressed\sratoolkit.2.5.0-win64\bin\fastq-dump -X 5 -Z

SRR390728
Read 5 spots for SRR390728
Written 5 spots for SRR390728
@SRR390728.1 1 length=72
CATTCTTCACGTAGTTCTCGAGCCTTGGTTTTCAGCGATGGAGAATGACTTTGACAAGCTGAGAGAAGNTNC
+SRR390728.1 1 length=72
;;;;;;;;;;;;;;;;;;;;;;;;;;;9;;665142;;;;;;;;;;;;;;;;;;;;;;;;;;;;;96;;;;(
@SRR390728.2 2 length=72
AAGTAGGTCTCGTCTGTGTTTTCTACGAGCTTGTGTTCCAGCTGACCCACTCCCTGGGTGGGGGGACTGGGT
+SRR390728.2 2 length=72
;;;;;;;;;;;;;;;;;4;;;;3;393.1+4;;5;;;;;;;;;;;;;;;;;;;;;;;;9;;;;;;;464262

(.....)

where i can find the downloaded file???? i was going to download a sra file from GEO.

sequencing rna-seq • 3.7k views
ADD COMMENTlink modified 3 months ago by Andy.Judell0 • written 4.4 years ago by Angel3.5k
2
gravatar for genomax
6 months ago by
genomax71k
United States
genomax71k wrote:

Since this old thread has been re-activated I will add two current methods that should be used for this purpose instead of using SRAtoolkit:

ADD COMMENTlink modified 6 months ago • written 6 months ago by genomax71k

genomax as you suggested to me already, Fast download of FASTQ files from the European Nucleotide Archive (ENA) is quite applicable

ADD REPLYlink modified 6 months ago by ATpoint23k • written 6 months ago by Angel3.5k

This tutorial also contains a section on how to use the sratoolkit (prefetch and fastq-dump) efficiently (bottom of the tutorial).

ADD REPLYlink written 6 months ago by ATpoint23k
0
gravatar for Devon Ryan
4.4 years ago by
Devon Ryan92k
Freiburg, Germany
Devon Ryan92k wrote:

While you could download the file from GEO (or just directly from SRA), it would seem easier to just remove the -Z option and allow fastq-dump to write the fastq files for you. Exceedingly few programs directly accept SRA files, but pretty much everything will take fastq.

BTW, that's a paired-end dataset, so make sure you specify --split-files.

ADD COMMENTlink written 4.4 years ago by Devon Ryan92k

By default (now in 2019), one should use --split-3 to separate potential singletons that might mess up the pairwise structure of the two mate fastq files which eventually might crash the aligner.

ADD REPLYlink modified 6 months ago • written 6 months ago by ATpoint23k
0
gravatar for cigdemselli
6 months ago by
cigdemselli10
cigdemselli10 wrote:

The default location for the "download repository" is:

Linux: /home/[user_name]/ncbi/public
Mac OS X: /Users/[user_name]/ncbi/public
Windows: C:\Users\[user_name]\ncbi\public

Please see this link for more details: https://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=toolkit_doc&f=std#s-4

ADD COMMENTlink modified 6 months ago by ATpoint23k • written 6 months ago by cigdemselli10

Hi, welcome to Biostars :)

Please use the formatting bar to indicate code examples, paths, example data etc. I did the changes for you this time.

enter image description here

ADD REPLYlink modified 6 months ago • written 6 months ago by ATpoint23k
0
gravatar for Andy.Judell
3 months ago by
Andy.Judell0 wrote:

I had to use the find command to find the directory which is located at the root directory rather than the user directory. prefetch downloads SRA data to ~/ncbi/public/sra despite having the tools installed at /home/[user-name]/ncbi

ADD COMMENTlink written 3 months ago by Andy.Judell0
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 531 users visited in the last hour