bam file flags- interpretation
2
0
Entering edit mode
7.3 years ago
krp0001 ▴ 30

 

Dear Users, 

Recently i have aligned my illumina reads to my reference genome. I have gone through sam file specifications but, it is quiet difficult to understand. 

It would be great help if some one could explain the bam flags below.

few line of my aligned bam file.

HISEQ:115:C49JYACXX:4:1114:10901:17520  163     scaffold1       1       7       4M2I94M =       208     307     GCACAGAACTTTTTATTGAACAATTGGGCTACTAAATATGCTTACCAAACTCTATGGTAGTGTAGTCACAGTCTCTTAGTAGTAGTATCGATATATTGTA    CC@FFFFFFHHHHJJJJIJJJIJJJIJJJGJIJIIJIJIIIJIJJGIJIIHIIJJJJFHIGHGBHCGIJIJIJJJGIJJCEHHHHHHFFFFDDDEFEEEE    AS:i:-21        XS:i:0  XN:i:0  XM:i:2  XO:i:1  XG:i:2  NM:i:4  MD:Z:0A2G94     YS:i:-11        YT:Z:CP

Thank you

 

Assembly • 6.1k views
ADD COMMENT
1
Entering edit mode
ADD REPLY
2
Entering edit mode
7.3 years ago

There is a neat app to explain the SAM flags: http://broadinstitute.github.io/picard/explain-flags.html

ADD COMMENT
0
Entering edit mode

Thats worth the effort!

ADD REPLY
0
Entering edit mode

Thank you Zev, for your quick reply..!

ADD REPLY

Login before adding your answer.

Traffic: 2116 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6