Input format for RNAfold

Question

[biousex]

Hi all,

I'm using RNAfold command (Vienna package) to draw RNA secondary structure starting from 2 sequences:

• first one is a mRna sequence (for example: "ACUGAGCUUA");
• second one is a miRna sequence (for example: "GCGAUUAGGC");

RNAfold reference says input type is a single line sequence, something like "CGACGTAGATGCTAGCTGACTCGATGC".

My question is: I need to build a unique string joining "ACUGAGCUUA" + "GCGAUUAGGC" in "ACUGAGCUUAGCGAUUAGGC" before I send input data?

Thanks in advance!

[Devon Ryan]

It sounds like you're not trying to fold anything, but see if the miRNA sequence might target the mRNA fragment. RNAfold is meant for single stranded RNA folding.

[biousex]

Thanks for your answer, i use two sequences i know they match perfectly, because they come from another software used to predict matching. I can use RNAfold anyway?

[Devon Ryan]

Sure, but to what end? If the prediction software didn't provide the predicted base pairing and that's what you need then you could just link the two sequences by 5 or so Ns, which should provide a sufficient hairpin sequence.

[biousex]

I try to explain better my problem: I'm using a prediction software, by which I can obtain correct paring, but I don't have a tool to draw secondary structure, so my coworker suggests me use RNAfold (or RNAplot, the same, because I need only the ps file). I'm on the right way?

P.s.: I'm sorry for my (bad) English... :(

[Devon Ryan]

I imagine the RNAduplex command would be more useful then.

[biousex]

Just seen RNAduplex reference, but it seems there isn't any way to draw the secondary structure. I need a ps/jpeg/png/svg (or something else) file output file with it.

[Devon Ryan]

Then use RNAcofold. You should be able to look through the ViennaRNA documentation for other options.

[biousex]

RNAcofold seems to be better. I'll try and... cross the fingers for me :D

Thanks a lot!