Error Runnin miRDeep2
1
0
Entering edit mode
6.1 years ago
pm2012 ▴ 100

Hi All

I am trying to run miRDeep2 for the differential expression of miRNA in my dataset. I ran the mapper.pl without much hassle. However, I can't get the miRDeep2.pl to run and keep getting errors:

Here's the error that I am getting:

Error: problem with /data/lab/Homo_sapiens/Ensembl/GRCh37/Sequence/BowtieIndex/new_genome.fa
Error in line 9.221.351: The sequence

CCRRGCTTGGTTCTAACAATGAATTTAATAAGAATTGTATTTAATCAATGTTTAAATATA

contains characters others than [acgtnACGTN]

Please check your file for the following issues:

I.  Sequences are allowed only to comprise characters [ACGTNacgtn].
II. Identifiers are not allowed to have withespaces.

I got the error before for a nucleotide M in another sequence within the genome.fa file. I replaced it with N manually. However, it's showing me error with another sequence. Is there a way to get around this? Maybe I am missing something. Any help is appreciated.

Here's my command that I used to run the program:

miRDeep2.pl ABC.clipped_collapsed.fa /data/lab/Homo_sapiens/Ensembl/GRCh37/Sequence/BowtieIndex/new_genome.fa ABC.clipped_collapsed.arf /data/lab/Homo_sapiens/Ensembl/GRCh37/Annotation/SmallRNA/new_mature.fa none /data/lab/Homo_sapiens/Ensembl/GRCh37/Annotation/SmallRNA/new_precursor.fa

 

 

mirDeep2 microRNA sequencing • 2.3k views
ADD COMMENT
0
Entering edit mode
5.1 years ago
jon.brate ▴ 250

Did you fix this yet? It says your sequence contains R's. I got the same problem. I simply opened my genome in a text editor and searched for all characters besides AGCTN and replaced them with N. I only had two W's though.

ADD COMMENT
0
Entering edit mode

Hi jon.brate

I am new to NGS. I got the same error as above and i am trying to do as you said. But i have a doubt. should i delete all the characters besides ACGTNacgtn? For eg: This is one of the mirna. Here you can see 'b'. Should that character be also removed?

hsa-miR-125b-1-3p ACGGGUUAGGCUCUUGGGAGCU

Thanking You in advance

ADD REPLY
0
Entering edit mode

Sorry for the late answer, I am not sure I understand your problem. My error was about the reference genome, not the miRNAs. And I am not sure which 'b' character you refer to, the one in the miRNA name?

ADD REPLY

Login before adding your answer.

Traffic: 1715 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6