Question: Error Runnin miRDeep2
0
gravatar for pm2012
5.3 years ago by
pm201290
United States
pm201290 wrote:

Hi All

I am trying to run miRDeep2 for the differential expression of miRNA in my dataset. I ran the mapper.pl without much hassle. However, I can't get the miRDeep2.pl to run and keep getting errors:

Here's the error that I am getting:

Error: problem with /data/lab/Homo_sapiens/Ensembl/GRCh37/Sequence/BowtieIndex/new_genome.fa
Error in line 9.221.351: The sequence

CCRRGCTTGGTTCTAACAATGAATTTAATAAGAATTGTATTTAATCAATGTTTAAATATA

contains characters others than [acgtnACGTN]

Please check your file for the following issues:

I.  Sequences are allowed only to comprise characters [ACGTNacgtn].
II. Identifiers are not allowed to have withespaces.

I got the error before for a nucleotide M in another sequence within the genome.fa file. I replaced it with N manually. However, it's showing me error with another sequence. Is there a way to get around this? Maybe I am missing something. Any help is appreciated.

Here's my command that I used to run the program:

miRDeep2.pl ABC.clipped_collapsed.fa /data/lab/Homo_sapiens/Ensembl/GRCh37/Sequence/BowtieIndex/new_genome.fa ABC.clipped_collapsed.arf /data/lab/Homo_sapiens/Ensembl/GRCh37/Annotation/SmallRNA/new_mature.fa none /data/lab/Homo_sapiens/Ensembl/GRCh37/Annotation/SmallRNA/new_precursor.fa

 

 

sequencing microrna mirdeep2 • 2.1k views
ADD COMMENTlink modified 4.4 years ago by jon.brate250 • written 5.3 years ago by pm201290
0
gravatar for jon.brate
4.4 years ago by
jon.brate250
Norway
jon.brate250 wrote:

Did you fix this yet? It says your sequence contains R's. I got the same problem. I simply opened my genome in a text editor and searched for all characters besides AGCTN and replaced them with N. I only had two W's though.

ADD COMMENTlink written 4.4 years ago by jon.brate250

Hi jon.brate

I am new to NGS. I got the same error as above and i am trying to do as you said. But i have a doubt. should i delete all the characters besides ACGTNacgtn? For eg: This is one of the mirna. Here you can see 'b'. Should that character be also removed?

hsa-miR-125b-1-3p ACGGGUUAGGCUCUUGGGAGCU

Thanking You in advance

ADD REPLYlink written 22 months ago by nivya.james20160

Sorry for the late answer, I am not sure I understand your problem. My error was about the reference genome, not the miRNAs. And I am not sure which 'b' character you refer to, the one in the miRNA name?

ADD REPLYlink written 21 months ago by jon.brate250
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2253 users visited in the last hour