Question: Why the AT_covd CG_covg CpG_covd is zero???what happened with them?
0
gravatar for qwertyuiop201320142015
2.2 years ago by

hi,everyone

I have some problems in sample1.covg that is the part of genome music calc-covg.

#Gene    Length    Covered    AT_covd    CG_covd    CpG_covd
xuhb    13    13    0    0    0

 

Why the AT_covd CG_covg CpG_covd is zero???what happened with them?

 

My roi file has one line.

1 3 15 xuhb

My seq.fa is as follows:

>1
gaattcttcaaagagttccagatatccacaggcagattctacaaaagaag

 

My normal.fq is as follows:

@SEQ_ID
aattcttcaaagagttcca
+
2222222222222222222

My tumor.fq is as follows:

@SEQ_ID
aattcttcaaagagttcac
+
2222222222222222222

My bam-list file has one line as follows:

sample1 normal.bam tumor.bam

The command which i use is as follows:

genome music bmr calc-covg --bam-list bam1-list --output-dir ex1  --reference-sequence seq.fa --roi-file roi --normal-min-depth 1 --tumor-min-depth 1 --min-mapq 0;

 

Thank you very much.I am so worry about that problems.

calc-covg music genome • 572 views
ADD COMMENTlink written 2.2 years ago by qwertyuiop2013201420150

It's likely simply an issue with using lower-case characters in the .fa file

ADD REPLYlink written 2.2 years ago by Cyriac Kandoth4.6k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1676 users visited in the last hour