A Result From Mummer Alignment
1
3
Entering edit mode
9.4 years ago
Love ▴ 100

Hello, I run the mummer command for a pairwaise alignment

mummer -s -mum refer.txt query.txt > refer_query.align

The result is:

> query
1450      9370        21

gaggttgcagtgagctgagat

2122      9771        21

caaaaaaaaaaaaaaaaaaaa

3296      9570        26

gaggtcaggagatcgagaccatcctg

3318      9243        20

cctgaccaacatggtgaaac

3428      9353        30

cttgaacctgggaggcagaggttgcagtga

3461      9386        20

gagatcatgccactgcactc

3502      9773        20

aaaaaaaaaaaaaaaaaaag

My question is the result seems only display the matched strings in the query sequence. Can we also show the ones in the reference sequence?

alignment • 6.9k views
ADD COMMENT
1
Entering edit mode

If you are interested in variants, you can try dnadiff from MUMmer.

ADD REPLY
7
Entering edit mode
9.4 years ago
Vitis ★ 2.4k

I wonder what kind of alignment view you want or you need any specific format to parse with perl or python. The usual way I do nucleotide alignment with mummer is following:

align the two sequences

nucmer -p out seq1.fa seq2.fa

filter the results (delta format)

delta-filter -g -u 95 out.delta > out.fil.delta

show the alingment records (matching string coordinates)

show-coords -c -l -r -T out.fil.delta > out.fil.coords

show alignments for the regions you want (something like clustalw results)

show-aligns -r .....

ADD COMMENT
0
Entering edit mode

What I want to find at least say at least 80% identical match in reference and query. I need their positions in both sequence and letters. For example,

AGCTG 51 55 AGTTG 78 82

They have 4 same letters in 5. 4/5=80%

ADD REPLY
0
Entering edit mode

I think you may need to filter based on identity at delta-filter part then use 'show-coords' to find the coordinates, then fetch the sequences from seq1 and seq2. There are a lot more stuff in the manual that I can't remember but I'm sure you'll find solutions there.

ADD REPLY
0
Entering edit mode

Yes, I found delta-filter. What is meant by the header.
such as:

tagA1 tagB1 500 20000000

ADD REPLY
0
Entering edit mode

I might spoke it correctly. Do you mean I need to create a delta file first? My question is that because nucmer uses mummer for its maximal exact matching, can I also find non-match?Is it an align file? How to generate it?

ADD REPLY
0
Entering edit mode

I might spoke it incorrectly. Do you mean I need to create a delta file first? My question is that because nucmer uses mummer for its maximal exact matching, can I also find non-match?Is it an align file? How to generate it?

ADD REPLY
0
Entering edit mode

I used the command nucmer -p out seq1.fa seq2.fa to align the two sequences, but why the align file is empty?

ADD REPLY
0
Entering edit mode

any error message? You should see a file named out.delta, it's empty?

ADD REPLY
0
Entering edit mode

The file exists but is empty(0kb). Do seq1.fa and seq2.fa need same length?

ADD REPLY
0
Entering edit mode

that's quite strange, they don't have to be the same length. Are you sure they align with each other?

ADD REPLY
0
Entering edit mode

I upload files here. Could you help me to look at them?

ADD REPLY
0
Entering edit mode

I uploaded files here. Could you please help me to look at them?

ADD REPLY
0
Entering edit mode

simply run 'nucmer refer.txt query.txt' I got a 'out.delta' and the alignment information. I'm working on RedHat 64 bit with the most recent version of mummer. The output is like this:

NUCMER 91432805 20000 20000 3232 3487 9156 9412 44 44 0 33 -32 -1 -55 8 0

ADD REPLY
0
Entering edit mode

Any way to take this conversation to private emails? I may be able to help you troubleshoot the problem.

ADD REPLY
0
Entering edit mode

Yes, it is a good idea. How can I find your email from the profile?

ADD REPLY

Login before adding your answer.

Traffic: 1315 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6