How to remove technical read including known sequnce

Question

[cfarmeri]

Hi, I have a problem during QC and would like you to give me a hint.

I studied how to remove adapter sequence from 5' end and 3' end,

But I don't know the way to get rid of technical reads (not adapter) that contain known sequence.

For example, there following read in raw fastq file.

@id_01 length=62
GACTACGTACA**GAACAGATAATGACCATTTATAC**CGGAACAAATGGTTATCTGGATGGATTA
+id_01 length=62
IIIIIIIIIICCCFFFFFHHHHHJJJJJJJJJ<HHIJJJJJJJJJJFHIJJJJJIJJJJJJJ

The GAACAGATAATGACCATTTATAC sequence is generated from vector plasmid.

So I want to get rid of this read from all read before high-dimensional analysis.

Anyone has solution?

I'm sorry that I'm beginner in bioinformatics and my clumsy English.Thanks.

Answer 1

[Brian Bushnell]

You can use BBDuk for that:

bbduk.sh in=reads.fq out=clean.fq literal=GAACAGATAATGACCATTTATAC k=23

You can add the flag hdist=1 if you want to allow 1 substitution.