Question: HTSeq analysis for Illumina tissue samples?
gravatar for pbio
4.6 years ago by
United States
pbio120 wrote:


I have downloaded a few tissue bam files from illumina body map from the link

Now to get the read counts from each of the tissue sample bam files, I did HTSeq analysis. But unfortunately for a few tissues it worked really well but for a few tissues it ended up showing different error each time I run HTSeq analysis.

The HTSeq command I am using for processing bam files is 

samtools view GRCh38.illumina.ovary.1.bam | htseq-count -i gene_id - Homo_sapiens.GRCh38.80.gtf > htseq.ovary.results.txt

shows an error of 

Error occured when processing SAM input (line 2):
  'pair_alignments' needs a sequence of paired-end alignments
  [Exception type: ValueError, raised in]

I tried sorting the sam files too, but still it dint work :( showed some error

Error occured when reading beginning of SAM/BAM file.

  [Exception type: StopIteration, raised in]

How to solve this issue pleaseeeeeee help someone!


rna-seq htseq-count illumina • 3.6k views
ADD COMMENTlink modified 3.9 years ago by Biostar ♦♦ 20 • written 4.6 years ago by pbio120
gravatar for geek_y
4.6 years ago by
geek_y10k wrote:

Error at the end of HT-seq Analysis and output.txt with 0 bytes in size

ADD COMMENTlink written 4.6 years ago by geek_y10k
Error occured when reading beginning of SAM/BAM file.
  ('SAM line does not contain at least 11 tab-delimited fields.', 'line 1')
  [Exception type: ValueError, raised in _HTSeq.pyx:1276]
ADD REPLYlink modified 3 months ago by RamRS25k • written 4.6 years ago by pbio120

The error is clear this time. SAM line does not contain at least 11 tab-delimited fields.', 'line 1' there is something wrong with your file. Why don't you paste few lines

samtools view <in.bam> | head
ADD REPLYlink modified 3 months ago by RamRS25k • written 4.6 years ago by geek_y10k

I am sorry for the delay in response, this is how to file looks like

HWI-BRUNOP16X_0001:3:64:13105:149752#0  97      KI270757.1      49010   0       50M     8       89223567        0       GCCAAAATTGACAAAT               GGGATCTAATTAAACTAAAGAGCTTCTGCACAGT      eaceaddfffdggggdggcdgfgfgggggfggggfdgggdgggdgggggh      RG:Z:ovary_50_fca       XT:A:R  NM:i:0 S               M:i:0   AM:i:0  X0:i:69 XM:i:0  XO:i:0  XG:i:0  MD:Z:50
HWI-BRUNOP16X_0001:6:25:9464:120176#0   0       KI270757.1      63302   25      75M     *       0       0       TGGTGAGCAATTTTTTCATGTGTT               TTTTGATTTGCATTTCTCTGATGGCCAGTGATGGTGAGCAATTTTTTCATG     gaggggggggggggggggggggggggfffgggggggggggfgggeggggggggggggghgggggegggggggggg    R               G:Z:ovary_75_fcb        XT:A:U  NM:i:37 X0:i:1  X1:i:0  XM:i:37 XO:i:0  XG:i:0  MD:Z:9T20C1G0C0A0T0G0A0A0T0G0T0C0T0T0C0T0T0T0T0G0A0G0A1G               0T2C0T1T0T0C0A1G1C0C0T0T2
HWI-BRUNOP16X_0001:6:66:18737:92611#0   0       KI270757.1      67475   0       75M     *       0       0       GATGTGGAGAAATAGGAACACTTT               TACACTGTTGGTGGGACTGTAAACTAGTTCAACCATTGTGGAAGTCAGTGT     ggggggggghgggggggggggggggfgggggggggfgggggggfgggggggggghgggggggefggggggggfef    R               G:Z:ovary_75_fcb        XT:A:R  NM:i:0  X0:i:4670       XM:i:0  XO:i:0  XG:i:0  MD:Z:75
HWI-BRUNOP16X_0001:6:43:20784:119867#0  0       KI270757.1      67490   0       75M     *       0       0       GAACACTTTTACAGTGTTGGTGGG               ACTGTAAACTAGTTCAACCATTGTGGAAGTCAGTGTGGCGATTCCTCAGTG     gfggggggggggggggggggegggggggggggggggggggfgggfggggggggggfgfgfegggaeggggggghe    R         
ADD REPLYlink modified 3 months ago by RamRS25k • written 4.6 years ago by pbio120

Thanks, the issue was solved using the following commands

samtools view -bf 1 GRCh38.illumina.ovary.1.bam > ovary.bam
samtools view ovary.bam | python -m HTSeq.scripts.count --type=CDS --idattr=gene_id --mode=union --stranded=yes - Homo_sapiens.GRCh38.80.gtf
ADD REPLYlink modified 3 months ago by RamRS25k • written 4.6 years ago by pbio120
Please log in to add an answer.


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 724 users visited in the last hour