Question: Quality control on 454 data
1
gravatar for deepkumar1983
4.3 years ago by
United States
deepkumar198340 wrote:

Dear Friends,

                 I am new to NGS field and after studing alot of literature on qualty control. I use trimmomatic, fastx and qtrim software for 454 rna seq data. I am attaching the fastqc output for that. But I am not happy with the per base sequence quality graph, per base GC content and per base sequence content. Any help will be appreciated.


 

Thanks

Deepak

 

rna-seq • 2.2k views
ADD COMMENTlink modified 4.3 years ago by Maxime B0 • written 4.3 years ago by deepkumar198340

What is your quality control pipeline ? 

ADD REPLYlink written 4.3 years ago by geek_y10.0k

I used trimmomatic all default option with headcrop 15. Then used that output as input for fastx tool kit with fastx_trmimmer and trim 8 base from the end of read. Next with fastq quality trimmer option is q 20 and p 30 remove low quality base. Finaaly used qtrim.

ADD REPLYlink written 4.3 years ago by deepkumar198340

You didn't actually attach anything for anyone to look at...

ADD REPLYlink modified 4.3 years ago • written 4.3 years ago by Daniel Swan13k

Hi Swan this is my output FastQC report. Please help me how to correct these errors.

ADD REPLYlink written 4.3 years ago by deepkumar198340

Where is the report ? Why don't u just give a Dropbox link ?

ADD REPLYlink written 4.3 years ago by geek_y10.0k

Hi this is the link of the file

https://www.dropbox.com/s/h6q97psk3gadf3h/Outputfile_fastqc.html?dl=0

My Pipeline Commands are

java -jar /opt/software/Trimmomatic-0.32/trimmomatic-0.32.jar SE SRR1646514.fastq SRR1646514_filter1.fastq ILLUMINACLIP:/opt/software/Trimmomatic-0.32/adapters/TruSeq2-SE.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36 HEADCROP:15
~/software/fastx_toolkit_0.0.13/fastx_trimmer -Q 33 -m 50 -t 9 -i SRR1646514_trimmomatics_filter.fastq -o SRR1646514_trimmomatics_filter_t_9_m_50.fastq
QTrim_v1_1/QTrim_v1_1 -m 30 -mode 2 -l 50 -out_format 2 -seq_id_stat -plot pdf -fastq ~/Desktop/SRR1646514_trimmomatics_filter.fastq
 

ADD REPLYlink modified 4.3 years ago • written 4.3 years ago by deepkumar198340
0
gravatar for Brian Bushnell
4.3 years ago by
Walnut Creek, USA
Brian Bushnell16k wrote:

Most trimming software is designed for Illumina data.  I suggest you download BBDuk, and use this command:

bbduk.sh in=reads.fq out=trimmed.fq ref=adapters.fa k=23 ktrim=r mink=11 edist=1 qtrim=rl trimq=15

That should provide substantially better output, as it uses optimal dual-ended quality-trimming and allows indels in the adapter sequence, which is important in 454 data.

 

ADD COMMENTlink written 4.3 years ago by Brian Bushnell16k
0
gravatar for Maxime B
4.3 years ago by
Maxime B0
Norway
Maxime B0 wrote:

You can try Prinseq if Trimmomatic doesn't suits you http://edwards.sdsu.edu/cgi-bin/prinseq/prinseq.cgi

For your data it would be something like :


perl prinseq-lite.pl -verbose -fastq SRR1646514.fastq -stats_all -graph_data test.gd -custom_params "AGATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG 1;AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT 1; AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG 1" -min_len 36 -YourOtherTrimmingOptions

perl prinseq-graphs.pl -i test.gd -html_all -o test
ADD COMMENTlink modified 4.3 years ago • written 4.3 years ago by Maxime B0
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 962 users visited in the last hour