Question: cutadapt cannot work on my fastq files
0
gravatar for Biodata_ed
3.9 years ago by
Biodata_ed20
United States
Biodata_ed20 wrote:

Hi, 

  I download .sra files from NCBI and convert them into fastq file by fastq-dump. So when I try to use cutadapt to trim my data, it shows:

    cutadapt -a AGATCGGAAGAGC -o SRR1658373.trimmed.fastq SRR1658373.fastq >> trim_report.txt
Error: at line 1, expected a line starting with '+'

So I head my fastq file, it shows:

Read 47403478 spots for SRR1658373.sra
Written 47403478 spots for SRR1658373.sra
ATGCAAATGCTTCTCAGATGATGAAAACTATTAGTATAACTGCTGTTAGGGAAATGAATGAGCCTATTGATGAGATAGTATTTCA
+SRR1658373.1 HWI-ST538:365:C2NBHACXX:1:1101:7347:2000 length=100
;7;###4<@@@@@@@@@@???@@@@@@??@?@@?@???????????????????????@@@@@@@@@@@@@??@@?@@@@@@???????????=>?????
@SRR1658373.2 HWI-ST538:365:C2NBHACXX:1:1101:1485:2103 length=100
CCAATAAAGATGGCCTAAGGTGACCTTCAACCAGAAATCCCCATGTCAGTGACACGTAAAACATGACAGCACCTTCAACACAACATGCAACCCAGACCCA
+SRR1658373.2 HWI-ST538:365:C2NBHACXX:1:1101:1485:2103 length=100
CCCFFFFFHHDHFHIGHIGIAEFHJIJIIJJIIJJJJGIIJJJJJIIJIHIFHIIIHGJIJIGHGIJJIIHHGHH@D>DFDDDDDDDDDDDDDDDBDDDD

 

How to make the fastq file capable for cutadapt? How to edit first 2 lines of fastq file?

Thanks a lot for the help!

 

Best,

Ellie

 

 

 

sequencing rna-seq • 1.9k views
ADD COMMENTlink modified 3.9 years ago by geek_y9.7k • written 3.9 years ago by Biodata_ed20
Read 47403478 spots for SRR1658373.sra
Written 47403478 spots for SRR1658373.sra​

Are these a part of your fastq files ? can you show the fastq-dump command ?

ADD REPLYlink written 3.9 years ago by geek_y9.7k

Thanks for the quick answer, here is my command for download files from NCBI:

/Users/ellie/sratoolkit.2.5.2-mac64/bin/prefetch SRR1658373

Then I upload  SRR1658373 to a server, then did the fastq-dump by using:

/opt/sratoolkit.2.3.5-2-centos_linux64/bin/fastq-dump.2.3.5.2 SRR1658373.sra > SRR1658373.fastq

Will the different version of sratoolkit causes this problem?

ADD REPLYlink written 3.9 years ago by Biodata_ed20
2
gravatar for geek_y
3.9 years ago by
geek_y9.7k
Barcelona/CRG/London/Imperial
geek_y9.7k wrote:

while running fastq-dump, you don't need to redirect the output. remove the ">" from your command. Just run

fastq-dump SRR1658373.sra

Read the documentation once and use appropriate options for your data.

ADD COMMENTlink written 3.9 years ago by geek_y9.7k

Thanks a lot! Now fastq files are right:)

ADD REPLYlink written 3.9 years ago by Biodata_ed20
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1069 users visited in the last hour