Question: cutadapt cannot work on my fastq files
0
gravatar for Ellie
3.0 years ago by
Ellie20
United States
Ellie20 wrote:

Hi, 

  I download .sra files from NCBI and convert them into fastq file by fastq-dump. So when I try to use cutadapt to trim my data, it shows:

    cutadapt -a AGATCGGAAGAGC -o SRR1658373.trimmed.fastq SRR1658373.fastq >> trim_report.txt
Error: at line 1, expected a line starting with '+'

So I head my fastq file, it shows:

Read 47403478 spots for SRR1658373.sra
Written 47403478 spots for SRR1658373.sra
ATGCAAATGCTTCTCAGATGATGAAAACTATTAGTATAACTGCTGTTAGGGAAATGAATGAGCCTATTGATGAGATAGTATTTCA
+SRR1658373.1 HWI-ST538:365:C2NBHACXX:1:1101:7347:2000 length=100
;7;###4<@@@@@@@@@@???@@@@@@??@?@@?@???????????????????????@@@@@@@@@@@@@??@@?@@@@@@???????????=>?????
@SRR1658373.2 HWI-ST538:365:C2NBHACXX:1:1101:1485:2103 length=100
CCAATAAAGATGGCCTAAGGTGACCTTCAACCAGAAATCCCCATGTCAGTGACACGTAAAACATGACAGCACCTTCAACACAACATGCAACCCAGACCCA
+SRR1658373.2 HWI-ST538:365:C2NBHACXX:1:1101:1485:2103 length=100
CCCFFFFFHHDHFHIGHIGIAEFHJIJIIJJIIJJJJGIIJJJJJIIJIHIFHIIIHGJIJIGHGIJJIIHHGHH@D>DFDDDDDDDDDDDDDDDBDDDD

 

How to make the fastq file capable for cutadapt? How to edit first 2 lines of fastq file?

Thanks a lot for the help!

 

Best,

Ellie

 

 

 

sequencing rna-seq • 1.6k views
ADD COMMENTlink modified 3.0 years ago by geek_y8.7k • written 3.0 years ago by Ellie20
Read 47403478 spots for SRR1658373.sra
Written 47403478 spots for SRR1658373.sra​

Are these a part of your fastq files ? can you show the fastq-dump command ?

ADD REPLYlink written 3.0 years ago by geek_y8.7k

Thanks for the quick answer, here is my command for download files from NCBI:

/Users/ellie/sratoolkit.2.5.2-mac64/bin/prefetch SRR1658373

Then I upload  SRR1658373 to a server, then did the fastq-dump by using:

/opt/sratoolkit.2.3.5-2-centos_linux64/bin/fastq-dump.2.3.5.2 SRR1658373.sra > SRR1658373.fastq

Will the different version of sratoolkit causes this problem?

ADD REPLYlink written 3.0 years ago by Ellie20
2
gravatar for geek_y
3.0 years ago by
geek_y8.7k
geek_y8.7k wrote:

while running fastq-dump, you don't need to redirect the output. remove the ">" from your command. Just run

fastq-dump SRR1658373.sra

Read the documentation once and use appropriate options for your data.

ADD COMMENTlink written 3.0 years ago by geek_y8.7k

Thanks a lot! Now fastq files are right:)

ADD REPLYlink written 3.0 years ago by Ellie20
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 633 users visited in the last hour