Error in accepted.bam tophat out
0
0
Entering edit mode
7.2 years ago

Hello all,

I have seen a weird problem with the TopHat2 output with an accepted.bam file.

Some query name are missing like following:

    73    chr10    27314766    50    75M    *    0    0    NTTCTGTTTCACTTCTCATAAACCATATTCTCAACCACACACTCATAAACCATTACTTGGTGCAGATTCCTTTTG    #AAFFJJJJJJJJJJJJJJJJJJJJJJJJJJJJJFJJJJJJJJJJJJJJJFJFFFJAFJJJJJJJAJAFA7FAFF    AS:i:-1    XN:i:0    XM:i:1    XO:i:0    XG:i:0    NM:i:1    MD:Z:0C74    YT:Z:UU    NH:i:1    XS:A:-
    89    chr12    69096534    50    31M6453N44M    *    0    0    ATTAGAAGAGGAAAGTGTATTCGCAGTTACTGCTGTTAATGCCAGTGAAAAAACAGTTGTGGAAGCGTTATTTCA    FJJ<FFFAAAJFFFFJJJJJJJJJJJJJJJJJJJJJJJJFJJFJJJJJJJJJJJJJJJJJJJJJJJJJJJFFFAA    AS:i:0    XM:i:0    XO:i:0    XG:i:0    MD:Z:75    NM:i:0    XS:A:+    NH:i:1

You could see field 1 is missing here.

Any idea why this problem?

Note: TopHat v2.0.9

Thank you.

RNA-Seq tophat tophat2 samtools • 1.8k views
ADD COMMENT
0
Entering edit mode

Can u post exact command used and also samtools view accepted_hits.bam | head -5

ADD REPLY
0
Entering edit mode

Hi Goutham,

There is a problem with 1 or 2 lines that too only some samples. The above mentioned lines are having problem none other than that in millions. Default command has been used like

tophat -g2 -r 150 --library-type fr-firststrand read1.fastq read2.fastq

Thank you

ADD REPLY
0
Entering edit mode

I have no idea but could troubleshoot. Can u show the output of:

cat read1.fastq | paste - - - - | grep -F -w "#AAFFJJJJJJJJJJJJJJJJJJJJJJJJJJJJJFJJJJJJJJJJJJJJJFJFFFJAFJJJJJJJAJAFA7FAFF" | head

or

cat read2.fastq | paste - - - - | grep -F -w "#AAFFJJJJJJJJJJJJJJJJJJJJJJJJJJJJJFJJJJJJJJJJJJJJJFJFFFJAFJJJJJJJAJAFA7FAFF" | head
ADD REPLY

Login before adding your answer.

Traffic: 1124 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6