Question: Error in accepted.bam tophat out
0
gravatar for tharveshliyakat
3.6 years ago by
France
tharveshliyakat60 wrote:

Hello all,

I have seen a weird problem with the TopHat2 output with an accepted.bam file.

Some query name are missing like following:
    73    chr10    27314766    50    75M    *    0    0    NTTCTGTTTCACTTCTCATAAACCATATTCTCAACCACACACTCATAAACCATTACTTGGTGCAGATTCCTTTTG    #AAFFJJJJJJJJJJJJJJJJJJJJJJJJJJJJJFJJJJJJJJJJJJJJJFJFFFJAFJJJJJJJAJAFA7FAFF    AS:i:-1    XN:i:0    XM:i:1    XO:i:0    XG:i:0    NM:i:1    MD:Z:0C74    YT:Z:UU    NH:i:1    XS:A:-
    89    chr12    69096534    50    31M6453N44M    *    0    0    ATTAGAAGAGGAAAGTGTATTCGCAGTTACTGCTGTTAATGCCAGTGAAAAAACAGTTGTGGAAGCGTTATTTCA    FJJ<FFFAAAJFFFFJJJJJJJJJJJJJJJJJJJJJJJJFJJFJJJJJJJJJJJJJJJJJJJJJJJJJJJFFFAA    AS:i:0    XM:i:0    XO:i:0    XG:i:0    MD:Z:75    NM:i:0    XS:A:+    NH:i:1

You could see field 1 is missing here.

Any idea why this problem?

Note: TopHat v2.0.9

Thank you.

 
rna-seq samtools tophat2 tophat • 1.1k views
ADD COMMENTlink modified 3.6 years ago • written 3.6 years ago by tharveshliyakat60

Can u post exact command used and also samtools view accepted_hits.bam | head -5

ADD REPLYlink written 3.6 years ago by geek_y9.3k

Hi Goutham,

There is a problem with 1 or 2 lines that too only some samples. The above mentioned lines are having problem none other than that in millions. Default command has been used like

tophat -g2 -r 150 --library-type fr-firststrand read1.fastq read2.fastq

 

Thank you.

ADD REPLYlink written 3.6 years ago by tharveshliyakat60

I have no idea but could troubleshoot. Can u show the output of:

cat read1.fastq | paste - - - - | grep -F -w "#AAFFJJJJJJJJJJJJJJJJJJJJJJJJJJJJJFJJJJJJJJJJJJJJJFJFFFJAFJJJJJJJAJAFA7FAFF" | head 

or

cat read2.fastq | paste - - - - | grep -F -w "#AAFFJJJJJJJJJJJJJJJJJJJJJJJJJJJJJFJJJJJJJJJJJJJJJFJFFFJAFJJJJJJJAJAFA7FAFF" | head
ADD REPLYlink modified 3.6 years ago • written 3.6 years ago by geek_y9.3k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1875 users visited in the last hour