Error message exonerate, negative HSP score.

Question

[Myggan]

Hello!

I'm trying to annotate a genome using exonerate.

My query is a fasta file of all reference genes, and my target is fasta file containing contigs.

I'm using the following command to run exonerate:

exonerate \
--model coding2genome \
query.fasta \
target.fasta \
--percent 90 \
--bestn 1
--score 100
--showtargetgff true \
--showalignment false \
1>output \
2>error

However, I get an error message that I would really appreciate some help in understanding what happens.

The program crashes with the last alignment run and the error message:

draw_hsp(74, 71404, 4, 0, 3, 3, "Bad HSP seed")
HSP info (0x7fff727a4f40)
    query_start  = [74]
    target_start = [71404]
    length       = [4]
    score        = [-1]
    cobs         = [0]
 ruler:[---===---===---===---===---===###---===---===###--]
 query:[gtagaacttgggcaatacttataacggcaa < TGATAATGATAA > tc]
       [   ||+    ! ... !    |+|  !!:! < |||! !|||||| > ||]
target:[tatgagaggtgttctgatagttgaatgcga < TGATTATGATAA > tc]
 ruler:[---===---===---===---===---===###---===---===###--]

 ruler:[-===---===---===---===---===]
 query:[aatatagataaccaagtcaaccttgatt]
       [|      ! !  ! ! ! !  !!     ]
target:[atgtggcaaatactattaattctgtgag]
 ruler:[-===---===---===---===---===]

sugar: YAL007C 74 12 - Chr4 71404 12 + -1

** FATAL ERROR **: Initial HSP score [-1] less than zero
exiting ...

So, I suppose that the HSP seed gets a negative score for some reason and the program crashes, I don't really see how to move on from here.

Anyone know why this is happening?

[schmidemanuel]

Hi

I am as well facing the same issue and it seems to be only persistent with the mode "coding2genome". If I use instead est2genome it succeeds successfully. The manual states:

This is similar to the est2genome model, except that the query sequence is translated during comparison, allowing a more sensitive comparison.

So I guess currently one has to use est2genome instead ....

[amoltej]

Hi Myggan,

Did you find answer for your error?