Question: fastx issue with reverse_complement , change in overepresented sequences
0
gravatar for gufernandez10
5.1 years ago by
Chile
gufernandez1010 wrote:

HI i'm working with fastx to get the reverse_complement from fastq file downloaded from sra and separated by sra-toolkit. My problem is after using fastx reverse_complement , the overepresented sequences identified by fastqc change. I would expect the number of reads overrepresented in the two file were the same and the sequence in the second file were the reverse_complement. The command used was: fastx_reverse_complement  -Q 33 -i FILE2.fastq -o FILE2_rev_com.fastq 

First two examples of overrepresented sequence in original file detected by fastqc:

AGGCTAGTTTGTTAGTGGCGTGTCCGTCCGCAGCTGGCAAGCGAATGTAA 143240 1.7818072306991304  
GGCTAGTTTGTTAGTGGCGTGTCCGTCCGCAGCTGGCAAGCGAATGTAAA 76434 0.9507864693609142  

 First two examples of overrepresented sequences in after reverse_complement over original file:

CTCGGTACTACATGCTTAGTCAGTCTTTACATTCGCTTGCCAGCTGCGGA 136155 1.6936746962848372  
CCTCGGTACTACATGCTTAGTCAGTCTTTACATTCGCTTGCCAGCTGCGG 70491 0.8768596306842531  

any idea what is happening here or what i'm doing wrong. 

rna-seq fastx fastq • 991 views
ADD COMMENTlink modified 5.1 years ago • written 5.1 years ago by gufernandez1010
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1815 users visited in the last hour