Question: microRNAseq data: is this normal or weird?
2
gravatar for niu2rseq
5.2 years ago by
niu2rseq70
United States
niu2rseq70 wrote:

Hello Dear Friends,

 

I am looking at my current miRNAseq data which was prepared with Illumina TruSeq small RNA sequencing kit.

One weird thing came to me is, the top abundant sequence reads that are actually around 1/4 of the total reads is:

>mpf_0_x20198538

TCCTGTACTGAGCTGCCCCGAGTTGGAATTCTCGGGTGCCAAGGAACTCC

And the second abundant read is actually just one nucleotide shorter:

>mpf_20198538_x18715060

TCCTGTACTGAGCTGCCCCGAGTGGAATTCTCGGGTGCCAAGGAACTCCA

After trimming the adapter TGGAATTCTCGGGTGCCAAGG, the sequencing reads indicate that more than 50% of total reads are pointing to one microRNA (miR-486). This definitely is really weird.

Have anyone seen this before? Is this possible in blood samples? Or this might be due to the library prep method? Or I am using the wrong way to look at these reads?

 

Can anyone give me some comments or hints? Thank you very much!

 

 

microrna ngs • 1.2k views
ADD COMMENTlink modified 5.2 years ago by Chirag Nepal2.3k • written 5.2 years ago by niu2rseq70
0
gravatar for Chirag Nepal
5.2 years ago by
Chirag Nepal2.3k
Copenhagen
Chirag Nepal2.3k wrote:

Trim those adapters and map the remaining sequences to the genome.

As you said 50% of reads map to that mirna, that portion might be slightly more than what one highly expressed mirna would be. If you have replicates that will be useful.

ADD COMMENTlink modified 5.2 years ago • written 5.2 years ago by Chirag Nepal2.3k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2459 users visited in the last hour
_