Question: Trimmomatic adapter.fa file with gene name, forward primer and reverse primer
0
gravatar for m.ghanatbari
5.0 years ago by
m.ghanatbari10
United States
m.ghanatbari10 wrote:

I've downloaded SRA file related to a paper, and in data processing part the paper says:

The raw seq data was trimmed using the Trimmomatic computer program version 0.30 to remove adaptor sequences, and mapped to the Human genome version hg19 by Bowtie 1.0.0 without any gaps and allowed for at most two mismatches.

I have two questions:

1. First one is about ILLUMINACLIP:~/adaptor.fa option in Trimmomatic, What should I put inside the adaptor.fa file?

At the end of paper I found this: The primer sequences are as follows (listed as gene name: forward primer; reverse primer).

ANAPC1: TGCCAAAAGAAATAGCAGTTCAG; TGCCAAAAGAAATAGCAGTTCAG; 
ANLN: GCCAGGCGAGAGAATCTTCA; GGCTGCTGGTTACTTGCTTC; 
SRSF6: ACAAGGAACGAACAAATGAGGG; GCTTCCAGAGTAAGATCGCCTAT; 
E2F8: ACCCAAGCTCAGCCATTGTA; GAGTCATAGTTGGTGGCCCT; 
HIPK1: CCAGTCAGCTTTGTACCCATC; TTGAAACGCAGGTGGACATA;

I read a post about that but that case contains only forward primer, but her I have reverse primer too. Do I need just copy the mentioned sequences in adaptor.fa without any changes?

2. Say I want to trim a file like SRR1185020.fastq using mentioned primers, what should the code for Trimmomatic look like? 

rna-seq • 1.7k views
ADD COMMENTlink written 5.0 years ago by m.ghanatbari10
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1028 users visited in the last hour