questions about TruSeq Adapter
1
0
Entering edit mode
6.1 years ago

Hi all,

I am ready to remove adapter contamination from my reads using trimmomatic. I have read the software manual and I found it include a palindrome mode to remove adapter. First, I need provide the adapter fasta file where need to specify the forward adapter and reverse adapter. I have 1 universal adapter and 24 adapters with specific index. I just do not know which is forward adapter, universal or adapters with index?

Thank you very much.

below are my adapters:

TruSeq Universal Adapter
5' AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
TruSeq Adapter, Index 1
5' GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 2
5' GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 3
5' GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 4
5' GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 5
5' GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 6
5' GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 7
5' GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 8
5' GATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 9
5' GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 10
5' GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAGCTTATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 11
5' GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCTACATCTCGTATGCCGTCTTCTGCTTG
.......
sequencing next-gen • 4.8k views
ADD COMMENT
0
Entering edit mode
6.1 years ago

Hi there,

Just put them all in one fasta file. Here is note from the docs

fastaWithAdaptersEtc: specifies the path to a fasta file containing all the adapters, PCR sequences etc. The naming of the various sequences within this file determines how they are used. See the section below or use one of the provided adapter files

Here is the link to the docs http://www.usadellab.org/cms/uploads/supplementary/Trimmomatic/TrimmomaticManual_V0.32.pdf

ADD COMMENT

Login before adding your answer.

Traffic: 2993 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6