Question: questions about TruSeq Adapter
0
gravatar for miaochenyong
3.6 years ago by
China
miaochenyong0 wrote:

Hi all,

I am ready to remove adapter contamination from my reads using trimmomatic. I have read the software manual and I found it include a palindrome mode to remove adapter. First, I need provide the adapter fasta file where need to specify the forward adapter and reverse adapter. I have 1 universal adapter and 24 adapters with specific index. I just do not know which is forward adapter, universal or adapters with index? 

Thank you very much.

below are my adapters:

TruSeq Universal Adapter
5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
TruSeq Adapter, Index 1 
5’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 2
5’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 3
5’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 4
5’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 5
5’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 6
5’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 7
5’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 8
5’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 9
5’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 10
5’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAGCTTATCTCGTATGCCGTCTTCTGCTTG
TruSeq Adapter, Index 11
5’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCTACATCTCGTATGCCGTCTTCTGCTTG

.......

 

sequencing next-gen • 3.0k views
ADD COMMENTlink modified 3.6 years ago by Kirill260 • written 3.6 years ago by miaochenyong0
0
gravatar for Kirill
3.6 years ago by
Kirill260
Australia
Kirill260 wrote:

Hi there, 

Just put them all in one fasta file. Here is note from the docs

fastaWithAdaptersEtc: specifies the path to a fasta file containing all the adapters, PCR sequences etc. The naming of the various sequences within this file determines how they are used. See the section below or use one of the provided adapter files

Here is the link to the docs http://www.usadellab.org/cms/uploads/supplementary/Trimmomatic/TrimmomaticManual_V0.32.pdf

ADD COMMENTlink written 3.6 years ago by Kirill260
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 674 users visited in the last hour