All the CIGAR strings of reads mapped by Bowtie are "I"

Question

[yhu10thu]

Hi, guys,

I used Bowtie to align CLIP-seq reads to genome with the parameter "-v 1" which allow the reads have one mismatch. But in the result, Bowtie treat all the nucleotides of reads as insertion. For example:

2-42    16      chr11   86397621        255     23M     *       0       0       GTCAACATCAGTCTGATAAGCTA IIIIIIIIIIIIIIIIIIIIIII XA:i:0  MD:Z:23 NM:i:0

Does any one have any idea what happened? What should I do to make it work?

Thanks,

Yue

Answer 1

[GouthamAtla]

IIIIIIIIIIIIIIIIIIIIIII is not insertions. It's the quality values of each base. 23M is the CIGAR string.

[yhu10thu]

I'm sorry...but the original sequence is TAGCTTATCAGACTGATGTTGAC, how does it match the sequence in the result?

[GouthamAtla]

It mapped to reverse strand. So its reverse compliment. The flag 16 indicates that.

[yhu10thu]

oh...I see, Thanks!