Question: All the CIGAR strings of reads mapped by Bowtie are "I"
0
gravatar for yhu10thu
4.2 years ago by
yhu10thu0
China
yhu10thu0 wrote:

Hi, guys,

I used Bowtie to align CLIP-seq reads to genome with the parameter "-v 1" which allow the reads have one mismatch. But in the result, Bowtie treat all the nucleotides of reads as insertion. For example:

2-42    16      chr11   86397621        255     23M     *       0       0       GTCAACATCAGTCTGATAAGCTA IIIIIIIIIIIIIIIIIIIIIII XA:i:0  MD:Z:23 NM:i:0

Does any one have any idea what happened? What should I do to make it work?

Thanks,

Yue

bowtie • 1.1k views
ADD COMMENTlink modified 10 months ago by Biostar ♦♦ 20 • written 4.2 years ago by yhu10thu0
2
gravatar for geek_y
4.2 years ago by
geek_y10k
Barcelona
geek_y10k wrote:

IIIIIIIIIIIIIIIIIIIIIII is not insertions. It's the quality values of each base. 23M is the CIGAR string.

ADD COMMENTlink modified 7 weeks ago by RamRS25k • written 4.2 years ago by geek_y10k

I'm sorry...but the original sequence is TAGCTTATCAGACTGATGTTGAC, how does it match the sequence in the result?

ADD REPLYlink written 4.2 years ago by yhu10thu0
1

It mapped to reverse strand. So its reverse compliment. The flag 16 indicates that.

ADD REPLYlink modified 4.2 years ago • written 4.2 years ago by geek_y10k

oh...I see, Thanks!

ADD REPLYlink written 4.2 years ago by yhu10thu0
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 815 users visited in the last hour