All the CIGAR strings of reads mapped by Bowtie are "I"
Entering edit mode
6.5 years ago
yhu10thu • 0

Hi, guys,

I used Bowtie to align CLIP-seq reads to genome with the parameter "-v 1" which allow the reads have one mismatch. But in the result, Bowtie treat all the nucleotides of reads as insertion. For example:

2-42    16      chr11   86397621        255     23M     *       0       0       GTCAACATCAGTCTGATAAGCTA IIIIIIIIIIIIIIIIIIIIIII XA:i:0  MD:Z:23 NM:i:0

Does any one have any idea what happened? What should I do to make it work?



bowtie • 1.6k views
Entering edit mode
6.5 years ago

IIIIIIIIIIIIIIIIIIIIIII is not insertions. It's the quality values of each base. 23M is the CIGAR string.

Entering edit mode

I'm sorry...but the original sequence is TAGCTTATCAGACTGATGTTGAC, how does it match the sequence in the result?

Entering edit mode

It mapped to reverse strand. So its reverse compliment. The flag 16 indicates that.

Entering edit mode

oh...I see, Thanks!


Login before adding your answer.

Traffic: 2533 users visited in the last hour
Help About
Access RSS

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6