Using cutadapt over multiple adapters
1
1
Entering edit mode
5.8 years ago
dgtiezzi ▴ 10

Using the FASTQC I have those overrepresented adapters (RNAseq data):

GATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATATCGTATGCCGT

GATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGT

GATCGGAAGAGCGGTTCAGCAGGAATGCCGAGATCGGAAGAGCGGTTCAG

 

How is the best approach to trim them out using cutadapt? Copy and paste the sequences after -a? Can I give multiple adapters at once?

 

 

 

cutadapt multiple adapters • 5.9k views
ADD COMMENT
4
Entering edit mode
5.8 years ago
Juke34 ★ 6.3k
Answer here: http://cutadapt.readthedocs.org/en/stable/guide.html#removing-adapters At "Multiple Adapters" paragraph. Briefly you can use -a option for each adapter, or use the parameter only one time providing a file containing adapters in fasta format.
ADD COMMENT
0
Entering edit mode

Question: would cutadapt -a AdapterSeq1 -a AdapterSeq2 -a AdapterSeq3 -o output.fastq input.fastq work?

ADD REPLY
0
Entering edit mode

It will work, but Cutadapt will only trim the adapter with the best match. Please refer to the section "Trimming more than one adapter from each read" in the same documentation as Juke-34 has mentioned. Excerpt from the documentation,

By default, at most one adapter sequence is removed from each read, even if multiple adapter sequences were provided. This can be changed by using the --times option (or its abbreviated form -n).

ADD REPLY

Login before adding your answer.

Traffic: 1266 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6