Question: Using cutadapt over multiple adapters
0
gravatar for dgtiezzi
3.4 years ago by
dgtiezzi0
United Kingdom
dgtiezzi0 wrote:

Using the FASTQC I have those overrepresented adapters (RNAseq data):

GATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATATCGTATGCCGT

GATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGT

GATCGGAAGAGCGGTTCAGCAGGAATGCCGAGATCGGAAGAGCGGTTCAG

 

How is the best approach to trim them out using cutadapt? Copy and paste the sequences after -a? Can I give multiple adapters at once?

 

 

 

cutadapt multiple adapters • 3.5k views
ADD COMMENTlink modified 3.4 years ago by Juke-342.2k • written 3.4 years ago by dgtiezzi0
3
gravatar for Juke-34
3.4 years ago by
Juke-342.2k
Sweden
Juke-342.2k wrote:
Answer here: http://cutadapt.readthedocs.org/en/stable/guide.html#removing-adapters At "Multiple Adapters" paragraph. Briefly you can use -a option for each adapter, or use the parameter only one time providing a file containing adapters in fasta format.
ADD COMMENTlink written 3.4 years ago by Juke-342.2k

Question: would cutadapt -a AdapterSeq1 -a AdapterSeq2 -a AdapterSeq3 -o output.fastq input.fastq work?

ADD REPLYlink written 22 months ago by bioinformaticsfilesdrive0
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 668 users visited in the last hour