Question: Using cutadapt over multiple adapters
1
gravatar for dgtiezzi
4.5 years ago by
dgtiezzi10
United Kingdom
dgtiezzi10 wrote:

Using the FASTQC I have those overrepresented adapters (RNAseq data):

GATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATATCGTATGCCGT

GATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGT

GATCGGAAGAGCGGTTCAGCAGGAATGCCGAGATCGGAAGAGCGGTTCAG

 

How is the best approach to trim them out using cutadapt? Copy and paste the sequences after -a? Can I give multiple adapters at once?

 

 

 

cutadapt multiple adapters • 4.6k views
ADD COMMENTlink modified 4.5 years ago by Juke344.1k • written 4.5 years ago by dgtiezzi10
4
gravatar for Juke34
4.5 years ago by
Juke344.1k
Sweden
Juke344.1k wrote:
Answer here: http://cutadapt.readthedocs.org/en/stable/guide.html#removing-adapters At "Multiple Adapters" paragraph. Briefly you can use -a option for each adapter, or use the parameter only one time providing a file containing adapters in fasta format.
ADD COMMENTlink written 4.5 years ago by Juke344.1k

Question: would cutadapt -a AdapterSeq1 -a AdapterSeq2 -a AdapterSeq3 -o output.fastq input.fastq work?

ADD REPLYlink written 2.9 years ago by bioinformaticsfilesdrive0

It will work, but Cutadapt will only trim the adapter with the best match. Please refer to the section "Trimming more than one adapter from each read" in the same documentation as Juke-34 has mentioned. Excerpt from the documentation,

By default, at most one adapter sequence is removed from each read, even if multiple adapter sequences were provided. This can be changed by using the --times option (or its abbreviated form -n).

ADD REPLYlink written 5 months ago by swathishekaran930
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1234 users visited in the last hour